MCM and a growing team of around 20 volunteers began documenting the innumerable deaths and other horrifying damage done by the “vaccines,” every week since February 2022, as “a vital public service”. Including news of injuries among the jabbed (primarily celebrities) and any other items (such as “vaxxidents” (lone vehicle accidents)) or data, “that will help reconfirm the abnormality of what’s going on worldwide, and its direct relation to the “vaccination” drive.” All in an effort “to break through the widespread denial of what’s happening.” [REF, READ]

The global slaughter going on as if invisibly today is happening all around us every day, yet “our free press” will not and/or can’t report it honestly, even as they too keep dropping dead and/or becoming horribly unwell…

…such mass denial is very gradually breaking down, as some few, and ever more, are waking up,…

Mark Crispin Miller

At no time in history have we witnessed so many “died suddenly“, “passed away unexpectedly“, “passed away at home” and “cause unknown” deaths of generally healthy adults and the young, including children. We are currently September 2024 and the sudden deaths haven’t stopped since they hit the headlines in large numbers beginning 2021. Athletes are dying suddenly, vehicle accidents appear to have increased, nurses and doctors are suddenly dying or diagnosed with cancer at unprecedented rates, and other employment sectors who were mandated to take the experimental COVID-19 injections have all had an surge in sudden deaths.

Whether the deaths are the result of a vaccine adverse events is mostly unknown, but the sheer numbers of reports coinciding with a mandated medical intervention together with the lack of concern or willingness to thoroughly investigate, by authorities seems telling!

Even if there are autopsies performed it is highly likely that the medical examiners don’t even look for spike protein damage to organs, as the late Dr Arne Burkardt and Dr Bakdhi revealed that the true vaccine-related cause of death is not being applied, and deaths get dismissed as “natural” (although unexpected) but cause unknown. “Unless you are looking for it and know what tests to make, you will not see the “calling card” of a vaccine death.”

• Mark Crispin Miller website – HERE
• “News from Underground” Substack – Those who died suddenly – ARCHIVES

On this website you will find more information:

• Sudden Adult Death Syndrome (SADS) & Deaths by Unknown Cause Headlines – HERE
• Reports of Sudden & Unexpected Deaths – HERE
• Excess Mortality – HERE
• Dr William Makis also reporting “died suddenly” – HERE

This page will only capture a snapshot of Mark Crispin Miller’s weekly reporting on “died suddenly”, turbo cancer and other celebrity anomalies etc., it’s intent is to simply draw your attention to his exhaustive documentation that the media fails to connect the dots on. Please Read articles for yourself – HERE

MCM Reports in reverse chronological order

2024

September 27, 2024 – 22 nurses, 50 infants “died suddenly” in the US this past week – READ

Septmbmer 25, 2024 – 72 bodybuilders (that we know of) have “died suddenly” worldwide these last 3+ years, while two were badly sickened – READ

September 23, 2024 – MCM: Since “vaccination” started, 91 rappers (that we know of) have “died suddenly” worldwide, with another 13 sickened – READ

September 21, 2024 – Thanks to the “vaccine,” appendixes are busting out all over! [and appendix cancer] – READ

• April 25, 2022 – JAMA Network: Risk of Appendicitis After mRNA COVID-19 Vaccination in a Danish Population – Kildegaard et al – READ
  • “Appendicitis has been reported as a potential adverse event after immunization with mRNA-based COVID-19 vaccines, based on trial data, adverse event report data, and observational data.”

September 19, 2024 – This past week, [ANOTHER] 36 nurses, 27 infants all “died suddenly” in the US – READ

September 11, 2024 – Elton John half-blinded by “severe eye infection”; Queen’s Brian May has “medical emergency”; Cure’s Roger O’Donnell has lymphoma; singer Kaitāia, MP Sorcha Eastwood’s mate have “rare blood cancer”- TV presenter Iain Dale in hospital with “medical emergency”; Irish TV architect Dermot Bannon left “in agony” by pulmonary embolism – READ

September 4, 2024 – 36 nurses “died suddenly” in the US this past week, and 7 high school football players dropped dead in August – READ

September 4, 2024 – In memory of those who “died suddenly” in Nigeria, Kenya, Zimbabwe, S. Africa, Lebanon, Turkey, India, Bangladesh, Japan, Malaysia, Australia and NZ, August 26-September 2, 2024 – READ

August 28, 2024 – 33 nurses “died suddenly” in the US this past week (working aged 29-64) – “No cause of death reported”, “passed away at home”, “passed away suddenly”, passed away “after a brief illness“, 2 year battles with cancer, cardiac arrest – READ

• 29 year old delivered baby without a heartbeat and then “diagnosed with a very aggressive form of cancer” – READ

August 26, 2024 – Danielle Fishel (“Boy Meets World”) has breast cancer; FL anchor Donna Bell has breast cancer; “Voice” champ Sundance Head’s wife Misty has cancer on her face; singer Peven Everett has lung cancer, Travel writer Rick Steves has prostate cancer; Pittsburgh radio’s Paul Rasmussen has multiple silent heart attacks; Yankee’s Alex Verdugo now allergic to his own tattoos and mitt; & more – READ

August 26, 2024 -Daryl Hall shuts down concert after three songs due to “COVID”; Kathleen Turner leaves stage mid-performance; Coal Chamber postpone tour; Shannon Powell cancels show after stroke, heart attack – Shows of all kinds can’t go on, thanks to the “vaccine” – READ

August 22, 2204 – John Fetterman has “COVID”; Momma Dee has “light stroke”; ESPN’s Victoria Arlen has on-air “health scare”; Top Chef alum Shirley Chung has Stage 4 cancer; Patriots’ Christian Barmore has blood clots
MN newsman Boyd Huppert’s “ongoing blood cancer battle”; NOLA sports icon Ed Daniels hospitalized in California; Dodger star Freddie Freeman’s son, 3, rushed to hospital with “rare condition”; more – READ

August 19, 2024 – Toni Braxton, Aerosmith retire from touring; Rod Stewart cancels 2 more shows (due to “COVID”); PinkPantheress cancels all this year’s shows; Pooh cancels show in Italy; Arijit Singh postpones UK tour
Comic John Tothill’s appendix bursts on stage in Edinburgh; ATI unable to join concert in Botswana; Australia’s Gretta Ray “has cancelled her shows to recover from a rare heart disease” – READ

August 16, 2024 – In Italy last week, 13 “died suddenly” in or near the water (on beach, swimming pool etc) – READ

August 16, 2024 – 23 nurses and 2 doctors “died suddenly” in the U.S. this week – Nurses: 18 had “no cause of death reported,” five “died suddenly” from cancer; all were 68 years old or under – READ

August 11, 2024 – Scenes from Dr. Mengele’s Olympics [Paris 2024] It was already clear from the opening ceremony that these games would be the sickest in Olympic history; but, this being the Age of COVID, there was far worse to come – READ

• Covid-stricken Noah Lyles collapses after getting bronze,
• Katie Ledecky has POTS. Swimming may help her manage it
• American wrestler met with devastating cardiac arrest during Paris Olympics
• Samoan boxing coach dies in Paris aged 60
• French athlete Alessia Zarbo collapsed on the track during Olympics 10,000m final
• Tamberi in hospital days before high jump defence…suspected kidney problem
• 38 year old athlete persevered despite cancer battle – recently discovered a tumour in her spine which led to hospitalisation just days before the Olympic Games
• Olympic shooter Kim Yeji collapses at press conference …due to “accumulated fatigue”, carried on a stretcher taken to hospital
• Two swimmers collapses on pool deck post-race at Paris Olympics

August 7, 2024 – In memory of those who “died suddenly” in the United States and worldwide, July 29-August 5, 2024 – Athletes: US (3), UK, Romania, Cameroon, Russia, India, Kazakhstan; musicians: US (3), UK, Holland, Switzerland, Spain (2), S. Africa, Malaysia; “vaxxidents”: US (2), Italy (4), NZ (2); & more – READ

• Crime novelist Marco Dibenedetto (a sudden illness at 52); journo Marica Remoli (36 sudden death); art professor Edoardo Di Mauro (64, passed away after a short illness); biologist Giuseppe Perugino (died suddenly at 52) ; 11 in the waters, on the beach; 23 at home; 4 in “vaxxidents” (lone vehicle accidents); & more – READ

July 31, 2024 – Olympian Karli Kisha has thyroid cancer; Teddi Mellencamp has skin cancer (again); Saints’ Jake Haener has “rare skin cancer”; Braves’ Max Fried out with neuritis; Harvey Weinstein rushed to hospital- Joe Benigno (“Real Housewives of New Jersey”) has prostate cancer; UNC’s Tylee Craft retires from football (cancer); Nebraska state senator Jane Raybould treated for blood cancer – READ

July 30, 2024 – Stevie Nicks postpones UK tour; Black Belt Eagle Scout cancels shows; Widespread Panic cancels Asheville run; Toto cancels show in Italy; VT musician Sarah King cancels tour, Lena Meyer-Landrut cancels yet another show in Germany; Al Di Meola talks about his heart attack on stage – READ

July 24, 2024 – This past week in the United States alone, 19 nurses have “died suddenly,” along with 12 inmates; while, in Italy alone, 20 people have “died suddenly” either on the beach, or in the water – READ

July 22,2024 – UK: Lauren Goodger’s little girl (mystery illness), Kate Garraway’s dad rushed to hospital (suspected stroke); IN: comic Sathiya has “stroke scare,” actor Samantha Ruth Prabhu has Myositis; AU: cyclist Chris Harper quits Tour de France (COVID-19 symptoms), BR: gospel singer Camila Campos has breast cancer; CA: wrestler Kevin Owens’ mom in hospital with “undisclosed medical issue”; Nigerian activist Kanu diagnosed with “complex medical conditions”; more – READ

July 21, 2024 – Steep Canyon Rangers postpone show; Jack Russell quits touring; Chief Keef postpones tour; CNN’s Sarah Sidner has breast cancer; Mamie Harris has Bell’s palsy; Ben Sasse’s wife diagnosed with epilepsy- “Serious health incident” has DJ Shortkut in the hospital; Philly TV anchor Mike Jerrick has prostate cancer; Louisiana state rep Aimee Adatto Freeman has breast cancer – READ

July 20, 2024 – IT: Rapper Fedez in ICU with internal bleeding, Jannik Sinner, 22, leaves Wimbledon with tachycardia; Indian actress Sumbul Touqueer has typhoid, DM Rajnath Singh’s health “suddenly deteriorates“, IT: TV host Andrea Delogu in ER (“illness”); Singapore: singer Joanna Dong has “tiny tumor” removed from breast; Filipina singer Angeline Quinto has gestational diabetes; & more – READ

• Addendum: nine countries’ reports of “sudden deaths” – READ

July 18, 2024 -Jonny Greenwood, Zombies cancel tours; actor Jarryd Nurden has lung cancer; soccer’s Chris Kamara has apraxia; Arabella Chi (“Love Island”) miscarries, has PCOS; comic Janey Godley starting chemo, Reggae’s Fantan Mojah, 47, has heart attack; Brazilian cellist Antonio Meneses has glioblastoma; top Norwegian triathlete Heiko Sepp crippled by Pfizer; Mayor Abi Mills of Lancaster has breast cancer – READ

July 14, 2024 – Whoopi Goldberg, Doug Emhoff “test positive for COVID again“; Queens of the Stone Age cancel tour; Red Hot Chili Peppers’ Josh Klinghoffer kills pedestrian; Browns’ Bernie Kosar, 60, “fighting for his life”- FL meteorologist Katie Garner, 36, has a “heart condition”; Janel Parrish (“Pretty Little Liars”) undergoes surgery for endometriosis; Rep. John Garamendi (D-CA) diagnosed with blood cancer; & more – READ

July 6, 2024 – And this news just came in (from Japan): Wrestler Minoru Suzuki collapses during match- It’s getting ever harder to keep up with all these mystery “collapses,” just as with all the “sudden deaths” – READ

July 6, 2024 – Cuba: Chacal “abruptly” exits concert; UK: TV stars Eamonn Holmes and Cat Dealey both get sick on camera, John Cameron has a heart attack on set, and Sir Geoffrey Boycott has cancer AGAIN -Germany: Lena Meyer-Landrut cancels concert; Denmark: cyclist Rolf Sørensen pulls out of Tour de France; Canada: hockey star Emile Chouinard has cancer; Taiwan: actress Chen Yuron has cancer; & more – READ

July 6, 2024 – Ann Wilson has cancer; Pink cancels show; Pearl Jam cancels more shows; Neil Young “suddenly” cancels tour; Willie Nelson misses show; Chris Evert beats cancer; Rep. Jackie Speier has breast cancer- Reality TV star Claudia Jordan “tests positive” for “Covid” AGAIN; country singer Chris Young’s step-father has a heart attack; A’s coach Mike Aldrete’s wife has multiple myeloma; & more – READ

July 3, 2024 – In memory of those who “died suddenly” in Canada, June 24-July 1, 2024- Journalist Lori Paris; Newfoundland: curler Connor Stapleton (26, C); Saskatchewan: psychologist Natasha Head (40); Alberta: dentist Jessica Simonar (38); Ontario: nurse Richard Mark; & 290 more – READ

June 30, 2024 – FL school bus hit by pickup smashes house; pickup plows into La. Whataburger; tractor-trailer wrecks NJ home; CA semi speeds wrong way for miles; pickup crashes into Buffalo home – and other “vaxxidents” – READ

June 30, 2024 – 21 Israelis have West Nile virus (2 dead); Indian actor Anushka Shetty has “rare laughing disease,” Hina Khan has cancer; Filipino actor Sam Milby, 40, has diabetes; Aussie TV’s Nat Barr has cancer- Malaysian singer Azharina Azhar, 39, has cancer; toddler collapses at Taj Mahal; Aussie mayor, 40, has heart attack; NZ Green Marama Davidson, TV news reader Joanna Paul-Robie have cancer; more – READ

June 30, 2024 – BC premier John Horgan has 3rd cancer; UK soccer great John Hansen out of hospital (“illness”), Jon Holmes, Adele Roberts have cancer; Greek pol Marios Karoyian, 63, recovering from heart attack- US “Army linked Covid soldier’s heart condition to Covid vaccine”; Mexican judge has heart attack during online hearing; referee collapses during Canada-Peru soccer game; & more – READ

June 30, 2024 – Pearl Jam cancels show; Willie Nelson misses show (“illness”); Neil Young halts tour (“illness”); frontmen Lou Koller, Raul Malo have cancer; ESPN’s Dick Vitale, FOX23’s Laura Mock (OK) have cancer- Cincinatti Bearcats’ Dontay Corleone, 21, has blood clots in lungs; gymnast Suni Lee, 21, has kidney disease; “Army linked soldier’s heart condition to Covid vaccine, says CBS reporter”; & more – READ

June 27, 2024 – Plane veers off runway at Newark Airport, grounding flights; crop dusting plane crashes into truck in CA; pilot dead after crashing into MA river; 2 killed after plane crashes into CO trailer park – It’s been RAINING PLANES this month...- READ

June 23, 2024 – One car plows through front of store (SD), another plows through front of house (UK); “medical emergency” causes truck crash in FL; German ambulance careens down steep slope near apartment building
“Teen Subway worker saves man who crashed near restaurant” because of “medical emergency” (NY); bus driver ferrying Italian soccer delegation has “sudden illness,” stops on highway; and more (Vaxxidents)- READ

June 22, 2024 – Bowler David Lawrence has motor neurone disease, BBC’s David Owen, weeping, offers cancer update; Michael Flatley blames castle for his cancer; German rocker Hartmut Engler crippled by osteoarthritis
Brazilian rugby’s Raquel Kochhann getting over cancer; footballer Nabil Bentaleb in French hospital with “illness”; Austrian actor Katy Karrenbauer has a stroke; Italian rapper Fedez hit by “illness” – READ

June 22, 2024 – David Talbot has another stroke; Dave Portnoy claims to have “beat cancer”; Vicki Gonzalez has breast cancer; Dr. Oz saves plane passenger mid-flight; TX Wesleyan coach Brian Wanamaker has cancer – Activist Malik Shabazz, 48, has “massive heart attack”; Canadian wrestler LuFisto in hospital with “flesh-eating bacteria”; Puerto Rican artist Don Omar has cancer; and more – READ

June 22, 2024 – Stevie Nicks cancels show; boxer Tramaine Williams collapses mid-match; Fox anchor Dave Hall’s “scary blood clot”; Mark Chesnutt has emergency heart surgery; soap star John York has 2 “rare cancers”– Missy Elliott’s “shocking diagnosis”; drag queen Stacy Layne Matthews in hospital with “spinal issue”; Barry Sanders’ “health scare ‘related to heart'”; Karen Derrico collapses in front of family – READ

June 20, 2024 – 7 vehicles, 2 signs hit in “suspected medical-related crash” (VT); small airplane crashes in front of CO home; car speeds wrong way on Irish motorway; car mounts pavement in front of Domino’s (UK) – “Bus driver unwell,” hits 2 parked cars (FR); “violent” crash of Corvette with Dodge Avenger sends 4 to hospital (Freeport, IL); driver sick at the wheel, truck hits camper in backyard (IT); & more – READ

June 19, 2024 – Dutch footballer’s wife has breast cancer; NZ woman has “sudden-onset epilepsy”; Aussie TikTok exec (and marathoner) diagnosed with cancer; Italy (as ever) sees a veritable plague of “sudden illness” -Turkish cop collapses doing crowd control at a concert; Ukrainian man goes into cardiac arrest while playing soccer; Thai heart attack victim “saved in the nick of time”; & more – READ

June 17, 2024 – 2 Marines go into cardiac arrest on same day; 2 TN sheriffs have pancreatic cancer; high schooler, 15, goes into cardiac arrest playing football; girl, 5, walks to school for help after mom collapses -7-year-old Belfast girl collapses on the way to school; CA docs find multiple myeloma while treating man for “catastrophic kidney malfunction”; PA FedEx driver collapses after ringing doorbell; more – READ

June 17, 2024 – Performers dropping dead, or falling sick, on stage. (Spain, Italy, India) – More unprecedented post-“vaccination” weirdness mid-performance – READ [What is happening outside of the limelight?]

June 17, 2024 – Musicians falling down, or passing out, or breaking down on stage—just like they NEVER did pre-2020! (US) – READ

• Bruce Springsteen, Ringo Starr, Chappell Roan, FM Symphony key musician collapses mid-song, Jeremy Camp surgery, Monica Collapses On Stage During Houston Concert, Omar Geles hospitalized in Miami after medical emergency, Adele suffers health scare during Las Vegas residency show
• Swedish rocker Dennis Lyxzén has “massive heart attack“; Danish actor Charlotte Bøving has cancer (again); S. Korean pop star Yoo Ara, 31, has cancer; Irish pol Jennifer Whitmore in ICU, Irish model Thalia Heffernan, 28, quits for health reasons; Danish singer Birthe Kjær has virus on vocal cords, Danish MP Inger Støjberg has emergency appendectomy; Nigerian prez falls in public; more – READ
• Lulu Santos has 3 illnesses in 1 week; Haitian PM Garry Conille has emergency surgery; Brit model Roxy Horner has diabetes, Hayley Tamaddon (“Emmerdale”), singer Amelia Lily both rushed to hospital – Antiguan pol Joanne Massiah “recovering well” after emergency surgery; Brit athlete Jessica Warner-Judd provisionally diagnosed with epilepsy after mid-race seizure – READ
• A “vaxxident”—a “fatal dump truck crash”—that DID make (local) news – READ

June 15, 2024 – Noam Chomsky can’t talk; Oprah Winfrey rushed to hospital; Carrie Underwood falls off stage; Jon Fetterman rear-ends another car (“for unknown reasons”); Giants’ Darren Waller retires at 31- Actor Justin Baldoni hospitalized (with an “infection”); streamer Fanum, 26, has a heart attack, “thought he was going to die”; hoopster Jenica Lewis, 16, diagnosed with diabetes – READ

May 23, 2024 – In memory of those who “died suddenly” in India, Bangladesh, Vietnam, China, Philippines, Malaysia, Australia and New Zealand, May 13-May 20, 2024, Aussie drummer Fred Noonan; Kiwi rugby player Brody Cameron (22); Indian filmmaker Biju Vattappara (54), ice cream mogul Raghunandan Kamath; Vietnamese actor Duc Tien (44); & more – READ

May 20, 2024 – Kim Zimmer has breast cancer; Amanda Doyle has breast cancer; Pokémon English actress has breast cancer; Mia Love has breast cancer; IA Senate leader’s brain cancer; Nadine Menendez has breast cancer – NH State senator collapses on Senate floor; “Beloved Chicago reporter Mike Lowe, 44, reveals stage 3 colon cancer diagnosis: ‘Never die easy'”; Guthrie’s ‘Skeleton Crew’ has “medical emergency”; more – READ

May 15, 2024 – “Vax” destroyed Chris Cuomo’s health; Ric Flair’s near-death experience; Al Kresta’s liver cancer diagnosis; Dead Poets Society cancels show; Kris Jenner’s “little tumor”; FL pol Vic Torres collapses – READ

• In memory of those who “died suddenly” in the United States, May 6-May 13, 2024 – Actors Susan Buckner (Grease), Susan Backlinie (Jaws); sax player David Sanborn; rockers Tommy Viator (Disincarnate), Steve Albini (Shellac); comic Rudy Moreno; baseballer Sean Burroughs (44); & more – READ

May 1, 2024 – In memory of those who “died suddenly” in the United States, April 22-April 29, 2024 – Actors David Gail (Beverly Hills 90210), Meg Bennet (Search For Tomorrow); agent Gayle Nachlis; filmmaker Dusty Kay; hoopster Ruben Douglas (44); footballer Korey Cunningham (28); & more – READ

April 30, 2024 – Argie footie Carlos Tevez in hospital w/ chest pains; Rod Stewart collab’s heart attack “shatters face”; Irish radio host Jesper Dein reveals heart failure; Danish radio host has heart haemorrhage – READ

April 18, 2024 – School bus crashes in NY, TX, WV; NJ driver passes out, “crashes into oncoming car”; FL driver plows into someone’s home; MO driver veers off road, hits ditch, flips over; UK driver hits lamp-post – “Bystanders save man from burning car in Vernon,” NY; “sudden illness” strikes four Italian drivers, puts six Italians in the hospital – READ

• In memory of those who “died suddenly” in Italy, April 8-April 15, 2024 – Actor Francesco Parise; footballer Mattia Giani (26); vaxx clinician Emma Pulvirenti; architect Salvatore Visone; hoopsters Edoardo Baj (17), Riccardo Fadda (23); 15 at home; 9 in “vaxxidents”; & more – READ

April 15, 2024 – Why do we track all these “sudden deaths” and crippling injuries? To get others NOT to get the “vax”; and to amass the evidence of this unprecedented crime against humanity – This crucial task—though incomplete, to say the least—gets ever harder to perform week after week, SO MANY are now suffering and/or dying; and so we need YOUR help to keep it up – READ

• Francis Collins has prostate cancer; Father Goya Hidalgo has “big cancerous tumor”; Isabella Strahan’s 3rd craniotomy; Purdue student, 22, dying of glioblastoma; SC 15-yr-old has brain bleed on pitch -“Probation union president suffers medical emergency after state board meeting”; “Nurse driving by saves life of teen having heart attack”; “Milan MS staff’s swift action saves student”; & more – READ

April 10, 2024 – Sunbathing for ONE DAY increases risk of fatal heart attack. Drinking just ONE Diet Coke per day now linked to deadly heart disease. Nigerians now dying of heart attacks from watching too much soccer.
“Golf is linked to increased risk of developing Lou Gehrig’s disease (ALS)”; “Cause of long Covid has finally been identified: low iron levels”; India sees NO link between the “vax” & heart attacks. – READ

• “Millions are “dying suddenly” all around the world; and yet, according to “our free press,” all those dying are not dying of what’s really killing them. Indeed, none of them are dying of what’s really killing them, since they’re all dying (suddenly) of something else.”

April 2, 2024 – UK: TV host Michaela Strachan’s pal dies of cancer, Martin Griffiths quits UN, goalie Ellie Roebuck has a stroke; Aussie fitness guru Ashy Bines’ brain aneurysm, TV’s Marcia Bines rushed to hospital, Spain: Bertín Osborne battling “long Covid”; NZ: “Real Housewives” star Marcia Wallace has skin cancer; British Airways pilot “incapacitated” mid-flight; AU: TV contestant’s “medical emergency”; more – READ

• In memory of those who “died suddenly” in the United Kingdom and Ireland, March 25, 2024-April 1, 2024 – BBC Radio exec Paul Chantler; rapper/producer Jevon; footballer Larry Lloyd; computer scientist Ross Anderson; publican Andy Martin (The Star and Garter); Irish judge John O’Hagan; & more – READ

March 30, 2024- Kate Beckinsdale, Greg Vaughan, Aussie boxing great Jeff Fenech, footy legend Peter Wynn, Italian singer Loredana Bertè “rushed to hospital”; Greg Gumbel, Bill Walton missing games – Athletic director Dan Rolfes, FL police sergeant Mike Williams, Canadian soccer coach Travis Rickard, Aussie TV contestant Lauren all suffer “medical emergencies” – READ

March 29, 2024 – Heart failure among Navy pilots up 973%; Arnold Schwarzenegger, Darryl Strawberry, Rip Michaels, Jeremy Camp, Roberto Duran, Damian 666 all down with heart disease -Egyptian soccer star Ahmed Refaat collapses on pitch after “heart stopped for more than an hour”; Dr. Dre, with brain aneurysm, had three strokes in 2021; & more – READ

March 11, 2024 – Drummers in the US (4), Canada (3), Germany, Italy (2) and India have “died suddenly” since December 23, 2023 – Our third compilation of such deaths since February, 2022 – READ

February 27, 2024 – UK: Fergie’s “new diagnosis of skin cancer”; Kate Middleton’s surgery “obviously major”; Trisha Goddard’s breast cancer returns; Amy Dowden rushed to hospital; Moira Stuart collapses at a party – READ

• Kansas’ Phil Ehart has major heart attack; Bears’ Steve McMichael needs blood transfusion; Jay McInerney has brain surgery; Toni Braxton’s near-fatal health scare; Amy Schumer’s “puffy, swollen face” -“Sutton Stracke suffers terrifying medical emergency while filming ‘RHOBH’ reunion”; triathlete Lesley Patterson’s husband has Stage 4 pancreatic cancer; soap star Lana Clay’s “rare disorder”; more – READ

February 5, 2024 – King Charles diagnosed with cancer- Since his parents, both “vaccinated,” “died suddenly” some months later, and since other royals (Kate Middleton, Sarah Ferguson) have also been stricken by mysterious ills, this news is quite striking – READ

February 4, 2024 – “Medical emergencies” at Honolulu City Council hearing; high schools in North and South Carolina; a middle school in Texas; a housefire in NY; a grain storage tank in Delaware – “Miami Commissioner Manolo Reyes announces that his cancer is in remission”; Iowa state senator diagnosed with pancreatic cancer – READ

February 2, 2024 – More than 10 policemen have “died suddenly” in Italy since January 1 – An article that mentions “vaccination” (!) notes that the policemen’s union has been looking for “a coherent analysis of the phenomenon,” but that the government appears to be stonewalling them – READ

January 28, 2024 – UK: comic Bobby Davro cancels shows; dancer James Jordan’s daughter, 3, has 2nd “medical emergency”; British MP, Indian pol have heart attacks; Swiss prez Viola Amherd cancels Austria trip (“COVID”)
“Vietnamese political prisoner Nguyen Thuy Hanh diagnosed with cancer”; Aussie TV presenter Grant Denyer’s “terrifying medical emergency” on camera; UK actor Jamie Dornan’s “heart attack symptoms” – READ

January 25, 2024 – In memory of those who “died suddenly” in the United States and worldwide, January 16-January 22, 2024 – Musicians in the US (6), Canada (2), Brazil (2), Germany (2), Poland, Latvia, Greece, S. Africa, Russia, Australia (2); doctors in the US, Canada, Brazil, Czechia, Belarus, Italy, NZ; & more – READ

• Kate Middleton’s “alarming” surgery; Sarah Ferguson’s 2nd cancer diagnosis; footballer Callum Ainley diagnosed with cancer; Chilean actor Robert Nicolini has a stroke; Spanish runner’s cardiac arrest -Actor Helen Flanagan’s daughter, 8, left paralyzed by “frightening health scare”; France: “A sick Richard Jouve will skip the Tour de Ski”; Indian pol Tammineni Veerabhadram’s heart/kidney dysfunction – READ
• Dejan Milojevic WAS “vaccinated,” then boosted; last week had a “medical emergency” at a team dinner—and is now dead. (“Our free press” calls this a “conspiracy theory.”) – READ
• Dejan Milojevic’s “medical emergency”; Snoop Dogg’s daughter’s “severe medical emergency”; Ashley Park’s “critical septic shock”; AZ’s Christian Koloko felled by blood clot; Al B. Sure in 2-month coma – “Good Morning Charleston anchor Alissa Holmes OK after on-air medical emergency”; Minneapolis weatherman Keith Marler’s “multiple health issues”; QVC’s Kim Gravel has Bell’s palsy; & more – READ

January 23, 2024 “It’s okay to pass away!”: Assisted suicide pitched, on YouTube, to Canadian CHILDREN – This latest outrage from Justin Trudeau’s death cult more than justifies the ouster of his government, and his indictment for murder—OR mass protests demanding it – READ

January 23, 2024 – So many actors and musicians and filmmakers “died suddenly” last year that the awards shows can’t “remember” all of them – READ, READ2

• It happened recently at BAFTA and the Emmys, just as it did at the Oscars in 2022 and 2023—and surely will again at the Academy Awards this March, [too many have died suddenly that recognising them all would take too much time and also draw attention to the unprecedented number of deaths]
• Not every celebrity who died in 2023 made it into this year’s Emmys In Memoriam tribute. – READ [too many died to recognise them all, and draw attention to the unprecedented numbers]
  • Among the (many) missing from the “In Memoriam” segment at last year’s Academy Awards: – READ

January 22, 2024 – Patrick Henningsen Show: Interview with Mark Crispin Miller – LISTEN, READ

• On 2024 as (what may well be) our worst-ever election year – about the evidence of fraud in past elections, the urgent need for voters in BOTH parties to face up to it, and the moral failure of the election integrity movement

January 21, 2024 – Just this past week, “medical emergencies” had cars crashing in Connecticut, Ohio, Virginia, Arizona, Massachusetts, Canada, UK and Italy (and one even smashed into the White House gates) – READ

January 19, 2024 – Cancer, cancer everywhere! “Our free press” IS reporting it—while blacking out the reason for it
Can all these journalists AND doctors be too dumb to see what’s causing THIS pandemic? Or are they just too corrupt to mention it? Either way, we’re in big trouble—and ALL of them must GO! – READ

January 17, 2024 – Moody Blues, CODE ORANGE cancel tours; LeAnn Rimes has precancerous cells removed; CBS’s Boomer Esiason & Phil Simms “out sick”; soccer coach Sven-Goran Eriksson “battling pancreatic cancer” – Alabama head coach Nick Saban, 72, retiring due to “health issues”; wrestler Afa the Wild Samoan “recovering from pneumonia, two heart attacks” – READ

January 15, 2024 -Sec. Lloyd Austin battling prostate cancer; Michael Strahan’s daughter has a brain tumor; BBC’s Glenn Campbell has a brain tumor; Kathy Brown has lung cancer; Lindsay Lohan’s dad has skin cancer ,”YouTuber Brian Barczyk enters hospice for pancreatic cancer”; CBS TV host suffers a “hypoxic brain injury” – READ

January 11, 2024 – There are now so many “sudden deaths” and “medical emergencies” that we need more researchers to track them. Can you help us?- We’re reaching out again for your donations to continue this important work; so, IF you can contribute anything in these hard times, please do so – READ

January 10, 2024 – Stop the presses! (Please!) A sampling of the dumbest and/or most dishonest headlines from the last six months – READ link in article to headlines:

• FDA leaders say thousands of Americans likely to die this winter because too many don’t trust vaccines
• Getting Vaccinated May Be Your Best Protection from Long COVID
• Unexplained sudden deaths in young adults not linked to Covid-19 vaccination, says ICMR study
• ‘A vicious cycle’: Low Covid-19 vaccination rates lead to fewer doses at pediatric offices. Now, some parents can’t find it [sic]
• Bill Gates warns the world is likely to smash through a critical warming threshold
• US Government Issues Public Health Alert Over Soup
• MIT researchers publish breakthrough study investigating whether the Oreo creme can be evenly split

January 9, 2024 – UK: NHS boss retires “due to ill health”; footballer Rikke Sevecke, 27, retires because of “heart condition”; Andrew Tate’s mother has a heart attack; BBC’s lolo Williams back on TV after heart attack – READ

January 6, 2024 – Christina Aguilera cancels shows; Corey Taylor cancels tour; Michael Bolton’s brain tumor surgery; Rep. Steve Scalise (R-LA) treated for multiple myeloma; Susan Sullivan’s lung cancer – More celebrities sidelined dramatically in just the last few days—and a sampling of the “rare”conditions now afflicting countless tots and babies (none famous, or related to celebrities) – READ

January 5, 2024 – Propaganda + mass “vaccination” = hell on earth – READ

January 3, 2024 – In memory of those who “died suddenly” in Italy, December 25, 2023-January 1, 2024
5 young children; 5 young adults; 2 doctors and a dentist; 6 while out and about; 13 at home; 3 in cars; 9 in “vaxxidents”; & more – READ

• In memory of those who “died suddenly” in the United Kingdom and Ireland, December 25, 2023-January 1, 2024 – Actor Tom Wilkinson; entrepreneur Bryan Ansell; councillor Peter Griffiths; footballer Gemma Wiseman; pro wrestler Kurtis ‘Mad Kurt’ Chapman; Irish software entrepreneur Pat McDonagh; & more – READ

January 1, 2024 – Fall “vaccine” uptake an “abysmal” 7%; more US pols pledge BANS on “vaccination”; TX AG Ken Paxton SUING Pfizer; 5G under fire in NYC; Walmart, Costco, Wegmans DROP self-checkout; & more – Happy New Year to the growing resistance right here in the USA. and especially to those of us who’ll work THIS year to make it SO big that it can’t fail, no matter what new horrors they throw at us – READ

2023

Too many reports to list all, here is but a RANDOM taste:

December 30, 2024 – In memory of the children who “died suddenly” in the USA and Canada in 2023 – Children 2-10 years old READ, READ 2, Children 11-20 years old READ 3, READ 4

December 30, 2024 – In memory of children who “died suddenly” in Canada and United States in 2023: Children under 2 – staggering number of child deaths in North America this year – READ, READ 2, READ 3, READ 4

December 24, 2023 – German TV newscaster goes aphasic on the air; Italian TV contestant now home “with an illness”; Indian actress hospitalized w/ brain hemorrhage; Pakistani cricketeer in hospital w/ appendicitis – NZ footballer “Corey Harawira-Naera set to retire after seizure”; “sudden illnesses,” collapses happening all over Italy; & more – READ

December 23, 2023 – 17 rock bassists have “died suddenly” worldwide since May 20, 2023 -This makes a total of 34 bassists reported to have “died suddenly” since we started posting these compilations in February, 2022 – READ

December 23, 2023 – 13 drummers have “died suddenly” worldwide since May 20, 2023 – This makes a total of 30 drummers reported to have “died suddenly” since we started posting these compilations in February, 2022 – READ

December 21, 2023 – Madonna in a coma; Celine Dion “has lost control of muscles”; Jelly Roll “extremely sick,” missed “Voice” finale’; Bret Michaels cancels show “due to illness”; Teddi Mellencamp “facing major surgery” – NYC anchor Kaity Tong (non-smoker) diagnosed with lung cancer; KC quarterback Mason Martin has “significant brain bleed”; Eagles quarterback Jalen Hurts reported injured “due to an illness” – READ

December 17, 2023 – Brazilian gospel singer Pedro Henrique dies on stage; Turkish MP Hasan Bitmez dies mid-speech; Mexican TV’s Paulina Mercado has brain tumor; Italian actor Beppe Grillo hospitalized w/ “sudden illness”- Guatemalan pop star Ricardo Arjona, German TV journalist Dunja Hayali both retire; Piers Morgan tests positive for “Covid,” blames the un-jabbed; NZ actor Martin Henderson’s “scary” illness; more – READ

• George Clooney “badly stricken” with “Covid”; Patti Smith, Skid Row cancel shows; actor Ross Marquand, musicians Danielle Colby, Joshua Ray Walker, NHL’s Kelly Chase, Tony Granato all have cancer -Patty Murin’s mother, Reds’ Jake Fraley’s daughter, GA “Santa Claus” all have cancer; Krayzie Bone’s “near-death experience”; Busy Philipps’ daughter’s (2nd) seizure; Joy Behar “tests positive”; more – READ
• Andrea Bocelli cancels shows; Spanish footballer Dragisa Gudelj collapses on the pitch; UK TV presenter Fiona Phillips has premature dementia; Ferdinand Marcos, Jr. diagnosed with COVID (again) – TV host’s wife has brain cancer; Linda Nolan’s brain tumors have shrunk; “Michael Bibi is cancer-free”; Italian bass’s throat affected during opera; footballer Roberto Scarnecchia’s heart attack; more – READ

December 2, 2023 – “Vaccination” is the greatest evil in the history of humanity, as these new studies variously PROVE – This IS a global Holocaust, and there is NO denying it; so we can’t let “our free press,” OR our governments, ignore, belittle or distort this overwhelming evidence – READ

November 30, 2023 – According to “our free press” and “the science,” what’s killing millions is NOT “vaccination.” No, it’s white bread, smartwatches, Daylight Savings Time, antibiotics, stevia, swimming, Christmas….- READ

November 28, 2023 – Pope hospitalized with lung inflammation; Stephen Colbert’s appendix bursts; Ozzy Osbourne reveals spinal tumor; Cher’s look worries fans (“She can’t even walk”); Jamie Foxx “still struggling” – PGA Tour winner John Senden “battling Parkinson’s”; “‘Bachelor’ Star Hailey Merkt Shares Health Update Following Cancer Diagnosis” – READ

November 25, 2023 – Kiss cancel shows as Paul Stanley “battles flu”; MTV’s Megan McKenna “rushed to hospital”; Sunwoo diagnosed with neuritis/neuralgia; DE Dylan Horton “steps away from Texans due to health issue” – “Number of kids rushed to hospital with highly-contagious RSV rises 434% in just 5 weeks”; UK sportswriter John Nicholson has “massive stroke”; BA passenger goes into cardiac arrest mid-flight – READ

November 5, 2023 – Brooke Shields had a seizure; Mark Chesnutt, Zombies cancel shows; Bret Michaels’ “cancer scare”; Bridgette Sampras has ovarian cancer; voice actor James Cathcart’s “cancer battle” – “Top Marine general hospitalized” (why?); KC Chiefs’ Patrick Mahomes “has an illness”; VA Tech’s Gabriel Williams rushed to hospital; Alan Ruck drives into pizzeria; Clea Shearer is now “cancer-free” – READ

October 29, 2023 – Peter Hotez sadly wonders WHY so many of his friends—all “champions of global health” (like him)—have died before their time – That spate of deaths, and his blindness to the reason for it, tell us clearly that the global medical establishment itself is deadlier by far than any virus – READ, SOURCE

October 25, 2023 – In memory of those who “died suddenly” in the United Kingdom and Ireland, October 16-October 23, 2023 – Actress Haydn Gwynne (“The Crown”); TV star Tony Husband; journo John Vidal; newsreader Sharon Plummer; Playboy model Tabby Brown; bodybuilder Christian Figueiredo; GAA stalwart Liam Peoples; & more – READ

October 4, 2023 – In memory of those who “died suddenly” in the United States and worldwide, September 25-October 2, 2023 – Doctors in US (2), Canada, Honduras, Brazil (& 4 nurses in US, 2 in Canada); pols in US (2), DR, Bahamas, Peru, Brazil, Azerbaijan, Ukraine, Russia (3); cops in US (2), Italy, India, Indonesia; & more – READ

September 29, 2023 – Springsteen, Aerosmith, Donny Osmond cancel shows; Al Di Meola has a heart attack on stage; Red Sox’s Tim Wakefield and wife both battling cancer; WWE star Manu, 38, “fighting for his life” – “Inside Toby Keith’s health battle and stomach cancer treatment”; Young M.A’s “personal health challenges”; Theo Burrell (“Antiques Roadshow”) “battling an aggressive form of brain cancer” – READ

September 6, 2023 – In memory of those who “died suddenly” in the United Kingdom and Ireland, August 28-September 4, 2023 – Rockers Jack Sonni (Dire Straits), Faye Fantarrow (21, C), RPO bassist Gareth Wood; Labor peer Lord Alan Haworth; Volvere CEO Jonathan Lander; Ireland: Moneycorp Europe CEO Bryan McSharry; & more – READ

September 3, 2023 – Mitch McConnell’s 2nd “freeze” on camera; Rep. Steve Scalise diagnosed with blood cancer; Metallica cancels show; Jenna Jameson given 1 year to live; John McEnroe skips US Open (CORRECTED) – “School districts in Kentucky, Texas shut down after ‘surge’ of illnesses”; “Paul Simon Reflects On Mortality As He Continues To Battle Various Health Issues” – READ

August 26, 2023 – UK singer Liam Payne’s “serious kidney infection”; NZ actor Jodie Rimmer’ rheumatoid arthritis (“excruciating pain”); 8-year-old girl has a stroke; 3 Belgian cyclists’ “severe heart problems” post-jab – Nine near-fatal episodes all over Italy; “Community [in Wellington] rallies behind owner of historic store facing breast cancer”; NZ doctors tell 15-year-old girl her agonies are “all in her head” – READ

August 6, 2024 – “Snoop Dogg cancels multiple concerts”; The Chicks cancel shows due to “ongoing illness”; Buffy Sainte-Marie quits performing “due to health concerns”; Nicko McBrain partly paralyzed by strok – Fans concerned by Mick Jagger’s frailty, Michael Bolton’s tremors – READ

August 3, 2023 – Why is leprosy a (sudden) thing in Florida, as Guillain Barré Syndrome is in Peru? And why all these (sudden) cancers in the UK, Belarus, Australia, AND heart problems in Italy, Israel, New Zealand (just to name a few)? – And yet there’s nothing to see here—especially if you have no eyes, no mind. – READ

August 2, 2023 – In memory of those who “died suddenly” in the United States, July 24-July 31, 2023 – Paul Reubens (Pee-wee Herman); Pamela Blair (“All My Children”); rockers Randy Meisner (The Eagles), Brad Houser (Edie Brickell & New Bohemians), Neal Langford (The Shins); writer Justin Peacock; more – READ

July 15, 2023 – 2 cardiac arrests @ Ed Sheeran concert, 17 hospitalized; Ron McElhenney diagnosed with “neurodevelopmental disorders” (at 46); Ty Pennington intubated; Morgan Freeman’s “medical emergency” – Wrestler Lodi undergoes quintuple bypass surgery after near-fatal heart attack; “UFC fighter’s debut called off because of rare brain disease” – READ

July 4, 2023 – Madonna intubated in ICU; Jimmy Buffett cancels Summerfest; Bebe Rexha’s hormone disorder; Michael Sweet’s “worrying conditions”; “What happened to Simon Cowell’s voice?”; Gina Tew’s “AIDS battle” – Twitch streamer Amouranth’s late stage ovarian failure; Home Edit’s Clea Shearer has breast cancer; Cleveland Guardians’ Terry Francona “not in the dugout”; Clyde Aikau collapses outside restaurant – READ

June 21, 2023 – Jesse Malin paralyzed by spinal stroke; Kesha “almost died”; James Taylor postpones concerts; Dionne Warwick cancels show; Robbie Williams halts concert; Li’l Wayne hit with “severe memory loss” – Blackpink’s Jennie leaves show early, with “deteriorating condition”; John Driskell Hopkins has ALS; Queens of the Stone Age frontman Josh Homme diagnosed with cancer – READ

June 14, 2023 – MCM interviewed by Greg Hunter, on my libel suit at NYU, and the COVID crisis as a “propaganda masterpiece” – READ, WATCH

June 11, 2023 – Pilots “incapacitated,” “falling ill,” suffering “medical emergencies,” in the US (3), UK, Ireland, Romania and Australia, since March, 2023 – READ

June 4, 2023 – 4 off-duty nurses save the lives of people “dying suddenly” of heart attacks; 150 planes grounded by American Airlines alone; 330 “COVID” papers withdrawn for scientific flaws – READ

May 31, 2023 – In memory of those who “died suddenly” in the United States, May 22-May 29, 2023 – “Big Brother” star Joseph Ada; rapper Doc Todd; big band drummer Ralph Humphrey; former U. Chicago president Robert Zimmer; high school swimmer Justin Carr; a spike in baby deaths in PA; & more – READ

• Spike in baby injuries and deaths in Pa. hospitals alarms patient safety agency

May 28, 2023 – Justin Bieber may retire “to focus on his health”; Aaron Sorkin knocked out by near-fatal stroke last fall; Iron Maiden’s Blaze Bayley had a heart attack; Night Rangers’ Jack Blades rushed to hospital – Lea Michele’s son, 2, has been in hospital for days; Frank Fritz (“American Pickers”) very ill since “massive stroke”; Oscar-winning make-up artist Greg Cannom suffering “major health setbacks” – READ

April 29, 2023 – Sam Smith cancels show; Bonnie Raitt postpones concert; Toni Braxton, Ray Romano have emergency heart surgery; Morbid Angel halts show; Five Finger Death Punch halts tour; Morgan Wallen cancels show – Richard Lewis has Parkinson’s; Bear Brown (“Alaskan Bush People”) hospitalized; Jenelle Evans (“Teen Mom”) has esophagus surgery; Eric Braeden has cancer; Pokeman actor has cancer; & more – READ

April 13, 2023 – “Jamie Foxx suffers medical emergency”; Gene Simmons falls ill on stage; Kathy Griffin gets MRI “after lung cancer battle”; George Thorogood’s “very serious medical condition” – Rep. Jennifer Wexton has Parkinson’s; wrestlers Chelsea Green & Sabu hospitalized; boxing photog Ed Mulholland has tongue/throat cancer; sportscaster Fred Toucher’s throat surgery; & more – READ

April 10, 2023 – Tiffany Dover is alive (she says on NBC)! – Why did she vanish, then? Because, she says, harassment by the “anti-vaxxers” was SO bad, and/or because she let her hospital’s PR department “handle” all “inquiries.” You be the judge. – READ

March 23, 2023 – In memory of those who “died suddenly” in India, Sri Lanka, Singapore, China, Indonesia, Timor, Malaysia, Australia and New Zealand, March 13-March 20, 2023 – Indian actor Sameer Khakhar, & an Indian bride the night before her wedding; Timorese human rights activist Sisto dos Santos; Australian actor Peter Hardy, TV executive Brian Walsh; & more – READ

March 19, 2023 – Bruce Springsteen, Amanda Bynes, Rod Stewart, George Ezra, rapper Jeno and 2 South Korean bands ALL cancel shows because of “illness” – Remember when—back in the 60’s and 70’s (and 80’s, 90’s and beyond, up through 2020)—performers often canceled shows because of illness, just like this? Me neither. – READ

March 1, 2023 – Justin Bieber cancels tour; Khloé Kardashian’s tumor removal; Ed Sheerin’s wife had tumor during pregnancy; Claire McCaskill’s grandson’s brain tumor; rockers Luke Rauch, Shawn Hook both have cancer – Dawn Lyn, 60, of “My Three Sons” recovering from brain surgery; Hoda Kotb absent from “Today” because of “family health matter”; Savannah Guthrie yanked off-set mid-show because of “COVID” – READ

February 26, 2023 – Woody Harrelson goes where no star has gone before on Saturday Night Live – And you could have heard a pin drop at the wonderful satiric climax of his monologue – READ, Woody Harrelson Monologue – SNL – WATCH

February 17, 2023 – Part 1: In memory of those who “died suddenly” in Canada, February 6 – February 13, 2023
B.C. pediatrician Paul Moxham; Alberta firefighter Chris Kinsella; Quebec footballer William Caron-Cabrera; Alberta architect Darrel Boies; a footballer in his sleep (17); & 422 more across Canada – READ, Part 2 – READ

February 3, 2023 – In memory of those who “died suddenly” in Canada, January 23-January 30, 2023 – Ontario doctors Terrance Blake McAllister, Jamie Kissick, dentist Michael Chernick; musical virtuoso Felix Taylor; fiddler Clinton Dutiaume; accessibility activist David Olney; 590 more across Canada – READ

January 26, 2023 – In memory of those who “died suddenly” in the United States, January 16-January 23, 2023 – David Crosby; NBA champ Chris Ford; NFL wide receiver Calvin Muhammad; Screaming Trees bassist Van Conner; Fox News exec Alan Komissaroff; blues artist Thomasina Winslow; & more – READ

January 20, 2023 – Good news! For those still capable of waking up, there’s now a powerful ANTIDOTE to all the deadly propaganda pushed by “our free press”: Ed Dowd’s “Cause Unknown” – READ, More on Ed Dowd – HERE

January 7, 2023 – In memory of those who “died suddenly” in India, Sri Lanka, China, Indonesia, Malaysia, Australia and New Zealand, December 26-January 2, 2022/2023 – Filmmaker Nitin Manmohan; Aussie TV star Bobby Driessen; fashion designer Daniel Lightfoot; Sunflower lead guitarist Chalana Piyumantha; songwriter Li Huiqun; 9 in a “vaxxident” in India; & more – READ

2022

Too many reports to list all, here is but a taste:

December 22, 2022 – In memory of those who “died suddenly” in the United States and worldwide, December 12-December 19, 2022 – Musicians in the US, Canada, Puerto Rico, UK (3), Belgium, Germany, Spain & Russia; politicians in Canada, Mexico, Finland, India, Australia & New Zealand; 3 chefs, 3 restauranteurs in Italy; & more – READ

December 10, 2022 – Aerosmith cancels Vegas show, LeAnn Rimes cancels US tour, Celine Dion cancels next year’s tour, Evanescence cancels Poland concert, Placebo halts UK/Ireland tour – What’s happening to all those musicians? Baffling, isn’t it? (Is it? Not at all.) – READ

December 9, 2022 – In memory of those who “died suddenly,” in the United Kingdom and Ireland, November 28-December 5 – Missing Welshman Casey Coulton, 18, found dead; Abby Hills, mum of 2, died (at 30) while jogging; “fit & healthy” Nikki Hills, 16, died of sepsis; 3 young dads; 2 sports fans died mid-game; & more – READ

December 3, 2022 – In memory of those who “died suddenly,” in the United States, November 21-November 28 – “Fame” singer Irene Cara; country singer Jake Flint (on his wedding day); actor Clarence Gilyard, Jr.; Def Jam artist Don Newkirk; fitness trainer Eric Fleishman; comic Freddie Roman; & more – READ

October 29, 2022 – In memory of those who ‘died suddenly,’ Canada, October 17-October 24 – Toronto city councillor Cynthia Lai; 12 babies in Nunavik (pop. 40,000) “died suddenly” (from “lack of housing”); Alberta’s new premier vows to cut “all ties” with WEF; and 147 – READ

October 23, 2022 – 114 medical professionals who “died suddenly”—in Russia – READ

October 23, 2022 – Teddi Mellencamp has new melanomas; Celine Dion cancels Vegas gig; Rep. Ashley Hinson cancels debate; Fox News’ John Roberts has 2nd “health scare”; Gina Tew treated for “AIDS-related blindness” – Latest (likely) NON-fatals in the Western Hemisphere include LeAnn Rimes’ husband in the ER, a Mexican actress keeling over on Colombian TV, & 1,000 VA high schoolers hit with “flu-like symptoms” – READ

October 8, 2022 – Justin Bieber cancels tour; Harry Styles postpones show; K. Flay “fights to restore hearing after sudden loss”; Teller undergoes open heart surgery; JJ Watt defibrillated (for a “calf injury”) – The latest US non-fatals include CNN anchor Kasie Hunt’s brain tumor, Texans WR John Metchie’s leukemia diagnosis, ESPN commentator Lee Corso’s missed show, & Kamala Harris’s (possible) “vaxxident” – READ

October 6, 2022 – In memory of those who ‘died suddenly,’ in Canada, September 26-October 3- It now turns out that over 60 doctors, not just 32, have “died suddenly” in Canada—along with, this week, hockey star Andrew Payette, and 345 others (!) nationwide – READ

September 24, 2022 – “This tour will be my last,” says Demi Lovato; “Toby Keith reveals stomach cancer battle”; JHU prof blasts CDC over spike in childhood heart damage; Nebraska high school football team cancels season – “X Factor” star Rylan Clark’s 2 episodes of heart failure, & Missouri State broadcaster Art Hain’s sudden “immune system disorder,” are also among this week’s “NON-fatals” in the US, Argentina & UK – READ

September 21, 2022 – In memory of those who ‘died suddenly,’ in Italy, September 12-September 19 – 4 doctors and a nurse; 3 chefs; 2 journalists; 9 found dead at home; 9 dropped dead on the street or shopping; 4 killed in “vaxxidents”; 5 died swimming; 3 died looking for mushrooms; & many more – READ

September 19,. 2022 – In memory of ALL those who’ve died RIGHT AFTER “vaccination” (although we’ll never know how many there have been, or will have been) – READ, READ2

• How about “died instantly” after vaccination? – READ

September 17, 2022 – In memory of those who ‘died suddenly,’ in the United Kingdom and Ireland, September 5-September 12 – Queen Elizabeth II; BBC Radio Ulster presenter Kim Lenaghan; reggae musician Angus “Drummie Zeb” Gaye; Alexander Sutherland, Lord Strathnaver (died at 40, falling off a cliff); and all too many more – READ

• Lest we forget, Her Majesty was “fully vaccinated and had a booster shot”—or so we were told – READ

September 12, 2022 – Justin Bieber (28) postpones tour; Jane Fonda diagnosed with 3rd type of cancer; Paul Schrader “can’t breathe,” due to “mystery illness”; and more NON-fatal mishaps in US – TV actress Pauley Perrette had “massive stroke” last year; Tulsa anchor Julie Chin had stroke (on TV) last week; QB Sam Hartman was sidelined by blood clots; and an odd 9-car crash in Mission Viejo – READ

September 10, 2022 – Actor Carlos Bonavides has heart attack on Mexican TV (claims later it was all a “joke”); TV news anchor keels over, moaning; and three Indian men drop dead while dancing – About the youngest of the three—a man of 20—the Hindustan Times suggests that the “loud music” may have killed him, while the “experts” quoted CAN’T CONCEIVE that the “vaccine” could be behind it all – READ

September 6, 2022 – Oklahoma news anchor has stroke on-air; Ohio high school football player has 6 feet of “blood clots” pulled from legs; Seattle ferry crashes for (apparently) no reason; and so on – READ

September 1, 2022 – In memory of those who ‘died suddenly,’ in Canada, August 22-August 29 – TV soap journalist Nelson Branco (48); YouTuber Steve Wallis’s wife Jessica Audrey (31); 2 paramedics, and a personal support worker (drowned in a swimming pool); and 133 more throughout Canada – READ

August 25, 2022 – VSRF Full Episode #44: The Pandemic of Propaganda – Mark Crispin Miller talks to Dr. Pierre Kory about the “pandemic of propaganda” (and how to stop it) – WATCH

August 20, 2022 – TV star “rushed to hospital,” Canadian MP “thrilled to be alive,” young athletes sidelined by bizarre diseases, and all too many other likely casualties of “vaccination” all around the world – News of (what would seem to be) NON-fatal consequences of the jab, from the US and Canada, the UK, Sweden, Portugal, Spain, Italy (where there have been a LOT of them, as usual) and India – READ

August 12, 2022 – In memory of those who “died suddenly” in the United Kingdom and Ireland, August 2-August 8 – Soap star Sam Gannon; top chef Alistair Little; Irish hurler Dillon Quirke (collapsed mid-game); Michael O’Brien (“Titan of Irish publishing”); animal rights campaigner Martina Comerford; & many more – READ

August 8, 2022 – JoJo, a “vaccinated” silverback gorilla in Chicago’s Brookfield Zoo, has now “died suddenly”—the second jabbed gorilla to die in captivity these last 3 months – The prior one, in a Texas zoo, died of “multiple organ failure”; and many other zoo animals also have died strangely since the “vaccination” drive began. So what about racehorses and police dogs? – READ

August 7, 2022 – A father calls the pharmacist who gave his son a “vaccination”—and myocarditis – Phone Call – READ

August 5, 2022 – We must remember those who died, and why—and then bring ALL their murderers to justice – READ

August 4, 2022 – A bus crash in The Bronx—and every other “vaxxident” in New York City—should have heads rolling in Manhattan, Albany and Washington, D.C. – READ

July 28, 2022 – What’s goin’ on? 50 great soul music artists have died (suddenly?) in 2022 – Why is this not news, beyond one website? Why has (say) the New York Times not picked it up, to look into the CAUSE of all those deaths? We know why…. – READ, Soul Tracks (list of 50) – ARCHIVE

July 18, 2022 – In Italy, “at least 11” vacationers drop dead on beaches, while 10 in Britain have “died suddenly” while swimming – Is it the “hot weather,” as Britain’s “free press” tells us? Or is it “SADS” that’s had so many people ending up dead in the water? Such lies are killers, no less than the true cause of so many deaths – READ

July 6, 2022 – In memory of those who “died suddenly” in India, China, Japan, Indonesia, the Philippines, Australia and New Zealand, June 28-July 4 – A film actress (and the husband of another) and an airline pilot in India; two filmmakers in Hong Kong; two government ministers in Indonesia; an Australian MP; a deputy mayor in New Zealand; and more – READ

• Linda Kramer (Aerosmith drummer’s wife), “Breakin'” star Bruno Falcon, US jet ski champion Eric the Eagle, YouTuber Technoblade, Xerox CEO John Visentin, two hikers, two firefighters, many more – READ

June 17, 2022 – Three more who “died suddenly,” but WITHOUT making news (as the vast majority do not) – Thus the only way to start to grasp the true toll of this global slaughter is through word of mouth, and online forums like this one – READ

June 3, 2022 – “Vaccidents” keep spiking all around the world—and “our free press” keeps on denying that the jabs have anything to do with it – All these non-fatal “vaccidents” are just as telling as the ones now killing people everywhere, “vaxxed” and “unvaxxed” alike – READ

June 1, 2022 – In memory of those who “died suddenly” in China, Korea, Malaysia, Indonesia, Australia and New Zealand, May 24-May 30 – An actor and a comedian in Korea, a 21-year-old soccer player in Malaysia (died after a match), an Indonesian policeman “died suddenly” on his birthday, two cousins in Australia, and all too many more – READ

May 26, 2022 – Stop the presses! CARY GRANT “died suddenly,” of a STROKE (in 1986)! – More bio-fascist propaganda meant to NORMALIZE the current global plague of “sudden deaths” post-“vaccination” – READ

• “As this unprecedented global spike in “sudden deaths” grows ever harder to conceal—with Ray Liotta, and TWO famous British drummers, Andy “Fletch” Fletcher of Depeche Mode, and Alan White of Yes, all having their untimely “unexpected deaths” reported just today—“our free press” struggles, ever more transparently, to make it seem as if this (real) pandemic isn’t happening.“
• “They’ve been doing it for months, primarily by running scores of articles highlighting pseudo-scientific “findings” that all sorts of things can kill you and/or your children: SIDS, “SADS,” “generic heart problems,” hot weather, cold weather, fish oil, environmental noise, birth control, skipping breakfast, sadness (“Broken Heart Syndrome,” fatal to women!), referees’ whistles (which only now are killing soccer players worldwide!), pizza margherita (which only now is fatal to Italians!), etc., etc.—anything and everything except the “vaccines” that have obviously caused this freaky uptick in all-cause mortality on every continent.”

May 22, 2022 – WAKE UP! 1,000+ studies have confirmed that those “vaccines” ARE just as dangerous as the overwhelming “anecdotal” evidence suggests – To those who “trust the science”: Hey, trust this! …the first 50 of over 1,000 scientific studies – READ

May 14, 2022 – Reykjavik: “All smart men find things out for themselves”: A talk on propaganda, by MCM, in Iceland – interview – READ, Watch PART 1, PART 2, PART 3

May 12, 2022 – In memory of those who “died suddenly” in Albania, Greece and (especially) Italy, May 3-May 9 – This week they “died suddenly” on the street, in their cars, on their bikes, at sea, in restaurants, in church, or were found dead at home; an actor, two soccer players, a doctor and a nurse, and more – READ

April 16, 2022 – Robert F. Kennedy Jr Podcast: Mark Crispin Miller discusses culture and propaganda in society with RFK Jr. – LISTEN, READ

April 14, 2022 – MCM interviewd by Dutch activist Elze van Hamelen: How do we know propaganda when we see it? (And why, so often, DON’T we know it when it’s right before our eyes?) – READ, WATCH

April 4, 2022 – At last night’s Grammy Awards, some famous people who “died suddenly” this past year were missing from the “In Memoriam” segment – The show’s producers followed the example of last Sunday’s Oscars, even though Pfizer/BioNTech were NOT among the sponsors – READ

April 1, 2022 – How “In Memoriam,” on Oscar night, was used to sell us even more “vaccines” – READ

March 30, 2022 – In memory of those who have “died suddenly” in the United States, March 22-28 – Four musicians (including Taylor Hawkins), four public servants, two students (who both “died suddenly” at school), and—among all too many others—several who “died suddenly of natural causes” – READ

March 22, 2022 – In memory of all those who “died suddenly” in the United States, March 15-21 – The body count includes five firefighters, six media workers, three “vaccine” advocates,” two cops and all too many more – READ

March 11, 2022 – Most of those “sudden deaths” go unreported by the media – My readers tell their stories of some fatal “vaccine” injuries that made no headlines – READ

March 9, 2022 – They’re trying to distract us from the global plague of “sudden deaths,” but there are now too many, so they can’t – An introduction to the latest summary of “sudden deaths” from March 1 – 7, 2022, in the US and all around the world – READ

• The global “vaccination” drive is taking a far larger toll than COVID ever did, or ever could – READ

March 9, 2022 – MCM and Dr. Zelenko talk about the psychopaths who brought us the “vaccines,” and then “Ukraine” – READ, More Dr Zelenko – HERE

• R&B Weekly Seminar: R&B Medical Fellowship (Jerusalem War Crimes Trials/Episode #25 — Tuesday, March 8th, 2022). Fellowship Chairman and Host: Dr. Vladimir Zelenko. Guest Speaker: Professor Mark Crispin Miller – WATCH

March 5, 2022 – “Vaccinated” singer/TV host Roslan Shah collapses live on camera – This sort of thing keeps happening, even though the situation in Ukraine was probably manipulated to distract us from the ever-growing toll of those “vaccines” – READ

March 3, 2022 – In memory of those who have “died suddenly” worldwide, February 22-28 – The toll appears to be especially high in the UK, Ireland and Nigeria – READ

February 27, 2022 – Now that COVID’s over, we’re all getting blasted with fake news about Ukraine—and it’s working – How many lies can the press pump out, before people see they’re all lies? – READ

• Coach Red Pill, who’s actually Over There (in Kiev), breaks down the Russian strategy, and Zelensky’s efforts to put his people in harm’s way – READ, WATCH

February 22, 2022 – In memory of all those who “died suddenly,” February 15-21 – This surge continues to confirm the awful truth that “our free press” keeps struggling to obscure – READ

• This past week, as grimly documented here, still more people of all ages, all around the world, have suddenly dropped dead, either with no cause reported, or because of “unexpected” heart attacks, strokes, blood clots or cardiac arrest; or they have been felled before their time by very sudden cases of aggressive cancer—all “adverse events” now widely recognized (by all disinterested experts) as common “vaccine” injuries.”

February 16, 2022 – They all “died suddenly” just this past week (February 8-14) – See how many “sudden deaths” have made some news—while “our free press” continues to DENY this Holocaust, and thereby keeps it going – READ

• “…let’s review how this unprecedented global spike in sudden death has been deliberately obscured by “our free press.”“
• Headlines the “free press” are using to “normalise” the ever-growing global sudden death toll
  • ‘Broken heart’ cases surge during COVID, especially among women
  • Geneticists find clues to sudden unexplained child deaths
  • How the falsehood of athletes dying of coronavirus vaccines spread
• here and there, the painful truth has quietly come out:
  • Woman Died of Allergic Reaction to COVID Vaccine, Autopsy Confirms
  • Autopsy Confirms NY College Student Died From “COVID-19 Vaccine-Related Myocarditis”
  • Lightning strikes twice – Two high schools sudden deaths on the same day

January 31, 2022 – “Sudden deaths” from January 25-31, 2022 – What used to be unusual in obits is (as it were) pandemic now – READ

January 31, 2022 – More “sudden deaths” from January, 2022 -These are deaths I did not know about when I compiled my prior updates on the toll that those “vaccines” are taking all around the world—and, clearly, by design – READ

January 30, 2022 – 31 “sudden deaths” in Italy this past month – And those are just the ones reported in the major media – READ

January 25, 2025 – Another 14 “sudden deaths” – READ

January 23, 2022 – 22 more “sudden deaths” reported just these past few days in 2022 – But, hey, who’s counting? No one but the likes of us, apparently – READ

January 11, 2022 -More “sudden deaths” reported here and there (but NOT by “our free press”) – How many will it take before they either tell the truth about what’s going on, or pay the price for covering it up? – READ

January 10, 2022 – What just came up on Google when I searched “died suddenly” – Seven obits from all over the US, including those for TWO celebrities—and a really helpful New York Times article on “how to help someone with grief after a sudden death” – READ

• The Times piece somehow fails to mention the “vaccine,” but does mention COVID-19 as a cause of “sudden death”!

2017

June 17, 2017 – Making News – Faking News – Big Apple Coffee Party forum on Mainstream Media disinformation and manipulation of the public- WATCH

• With former CIA analyst Ray McGovern and NYU Media Professor Mark Crispin Miller, with moderator Margaret Kimberley of the Black Agenda Report.

May 20, 2017 – Renegade Inc.: Conspiracy Theories – interview with MCM – READ & WATCH

• “One of the most divisive terms in the English language today is the phrase ‘conspiracy theory’. Its stigma has a chilling effect on people and the label subtly has the power to shut down enquiring minds and with them any inconvenient conversations.”
• Today “the term ‘fake news’ is being used as a US propaganda exercise to expedite war with Russia”

The post Prof. Mark Crispin Miller – In Memory of Those Who Died Suddenly first appeared on Totality of Evidence.

• Eradication is defined as the worldwide absence of a specific disease-causing agent in nature.
• Elimination of VPD transmission in a defined geographic area but vaccination must continue to prevent reemergence or Eliminating VPD because its a ” public health problem” requiring vaccination (tetanus which is not infectious is on the list in the context of pregnancy!)
• Control of VPD  to reduce “disease and death to low levels locally”!
• Advance Development for diseases that don’t currently have a vaccine! [2]

The moment a vaccine is registered for a new disease we suddenly have a new vaccine-preventable disease – which takes potential lives could be saved numbers even higher!

The post VPD Global Immunization goals now include eradicate, eliminate or control first appeared on Totality of Evidence.

The WHO’s objective, as set out in its Constitution, is the attainment by all peoples of the highest possible level of health

Health is… a state of complete physical, mental and social well-being and not merely the absence of disease or infirmity.

As is defined in WHO’s Constitution

The World Health Organisation (WHO) believes “vaccines” and “immunization” for everyone is the backbone of of the most cost effective “health” for all. The “recommendations” of the WHO profoundly influences global immunization programs. This is an attempt to understand the history behind the vaccine agenda.

The purpose of this page

This page will capture the web of WHO’s influential programs, frameworks, working groups and agendas relating to “vaccines” and “immunisation”. Every 10 years the World Health Organisation (WHO) plans a new agenda to focus their efforts, usually building on, or growing out of, the previous agenda that encapsulates vaccination.

The WHO brings together a unified and philanthropically funded voice of vaccination policy which ALWAYS starts with targeting the poor and developing nations and has now morphed into the “leave no one behind” under the banner of “equity” which is part of the Agenda 2030 Sustainable Development Goals (SDG). 14 of the 17 SDG’s are measured by vaccination coverage!

Many philanthropic non-government organisations (NGOs) or foundations donate to the WHO or support their efforts in parallel, no doubt profiting from the knowledge of what is pushed.

This page is a place for me to bookmark historical documents to piece together the vaccine agenda which grew from a $6 billion market in 2002 to $78.27 billion in 2023 and is well estimated to grow to $122.27 billion by 2030.

• Are vaccines really saving millions of lives each year as the WHO CLAIM?
• WHO on Youtube – HERE

History of the World Health Organization (ARCHIVE)

• The First 10 years (1948-1957) – READ
• The Second 10 years (1959- 1967) – READ
• The Third 10 years (1968 – 1977) – READ
• WHO “The History of Vaccination” – @2000

Links in reverse chronological order

This content will continuously be updated, it will never be complete as WHO changes so fast. How we got here is what I’m interested in.

2020

April 29, 2020 – WHO Target Product Profiles for COVID-19 vaccines v3 – ARCHIVE, updated April 6, 2022 – ARCHIVE

• Tables of “vaccine characteristic” with “preferred” and ” Critical or Minimal” criteria to meet – Stopping transmission was optional as a “critical or minimal” criteria.
• Targeting children and pregnant women was a “preferred” option from the beginning to establish “herd immunity” which is “transmission blocking”.

February 11-12 , 2020 – WHO Global Research Collaboration for Infectious Disease Preparedness (GLOPID-R): COVID 19 Public Health Emergency of International Concern (PHEIC) -Global research and innovation forum: towards a research roadmap – ARCHIVE

2018

2018 – Ted Talk: Christine Stabell-Benn: An unexpected vax vs unvax mortality study – WATCH

2017

May 2017 – WHO WHA – The Ministers of Health from 194 countries endorsed a new resolution on strengthening immunization to achieve the goals of the Global Vaccine Action Plan (GVAP) a roadmap to prevent millions of deaths through more equitable access to vaccines by 2020 – (via WHO Immunization coverage) ARCHIVE

• It recommends scaling up advocacy efforts to improve understanding of the value of vaccines and urgency of meeting the GVAP goals..The Secretariat will report back to the Health Assembly in 2018, 2020 and 2022 on the achievements against the GVAP goals and targets.”
• The main goal of the 2017 campaign with the theme #VaccinesWork is to raise awareness about the critical importance of full immunization throughout life, and its role in achieving the Sustainable Development Goals.

2016

May 2016 – WHO published An R&D BLUEPRINT for Action to Prevent Epidemics – Plan of Action – READ, PDF ARCHIVE, REF, A research and development blueprint for action to prevent epidemics – website ARCHIVES

• As a result of May 2015, 68th WHA agreement: “…welcomed the development of a blueprint, in consultation with Member States and relevant stakeholders, for accelerating research and development in epidemics or health emergency situations where there are no, or insufficient, preventive, and curative solutions, taking into account other relevant work streams within WHO” (WHA68(10))
• Justification: The 2014–2015 “West African Ebola epidemic, the largest and longest Ebola outbreak in history, outlined several strengths and weaknesses in the R&D response and emphasized the need to be better prepared for the next epidemic.” [Ebola R&D]
  • WHO has been tracking Ebola for years. Ebola virus first discovered 1976, “Ebola haemorrhagic fever (EHF) is one of the most virulent viral diseases known to humankind” – 2003 – ARCHIVE, Web ARCHIVE
• This Blueprint is “as a platform for accelerating R&D”. This document “presents the main directions for an effective R&D Preparedness strategy: the R&D Blueprint” to catalyze R&D activities for emerging pathogens
• National Regulatory Authorities (NRA) needed to be prepared to fast track approvals for the next epidemic

May 27, 2016 – WHO WER No 21, Vol 91, pp 265–284 – PDF

• Strategic Advisory Group of Experts (SAGE) on immunization met on April 12-14, 2016 – This report summarizes the discussions, conclusions and recommendations.
• At global level, 2016 was an important year for the Global Vaccine Action Plan (GVAP) and Decade of Vaccines– promoting vaccination
• “Approval of a vaccination coverage indicator under the child mortality target of the Sustainable Development Goals (SDGs) has not yet been obtained. SAGE urged WHO and countries to request an aspirational immunization indicator under the SDGs…Ensuring and sustaining immunization services disrupted by humanitarian crises [like “climate change”?] is an ongoing concern.”
• The WHO R&D Blueprint was highlighted. It aims at developing and implementing a roadmap for R&D preparedness for priority pathogens, and enabling rollout of efficient emergency R&D responses.
• Respiratory syncytial virus (RSV) vaccine development pipeline discussed [just in time for 2021 RSV surge], RSV should be added to WHO Global Influenza Surveillance and Response System (GISRS)
• Implementation of immunization in the context of Health Systems Strengthening (HSS) and Universal Health Coverage (UHC) – towards ensuring equitable and sustainable immunization goals !!
• Pre-empting and responding to vaccine supply shortages – Access to timely and affordable supplies of vaccines is an integrated component of the Middle Income Countries (MIC) strategy, presented at SAGE in April 2015… – key partners (such as UNICEF Supply Division, the Bill & Melinda Gates Foundation, GAVI, vaccine manufacturers and countries)”
• Concerned about stagnating immunization coverage, during its 2014 review of the GVAP SAGE – strategy to reduce missed opportunities for vaccination (MOV) – “A MOV occurs when a person eligible for vaccination, and with no valid contraindication, visits a health service facility and does not receive all of the recommended vaccines.” [It’s just like marketing!] “With little effort or cost…ensuring that all visitors to health centres are vaccinated can have a major impact on the coverage of national immunization programmes.” Current 32% MOV

2015

October 12-16, 2015 – WHO Expert Committee on Biological Standardization: Collaborative study: Calibration of Replacement International Standard for Diphtheria Toxoid for use in Flocculation Test – PDF, ARCHIVE [what exactly is a vaccine???]

• “Diphtheria vaccines form an essential component of the primary immunization schedule of children and have been part of the WHO Expanded Programme on Immunization (together with tetanus and pertussis components) since its inception in 1974
• “Diphtheria is caused by exotoxin-producing strains of the bacterium Corynebacterium diphtheriae. Active immunization against diphtheria is based on the use of diphtheria toxoid (DTxd), a chemically detoxified preparation of diphtheria toxin, to induce protective antibody responses.”
• The bulk toxoid intermediates of diphtheria vaccines can also be used as carrier proteins in polysaccharide conjugate vaccines against invasive bacterial infections caused by N. meningitidis, H. influenzae and S. pneumonia“
• DTxd is produced by growing the toxin-producing C. diphtheriae in liquid media and converting the toxin to inactive toxoid by treatment with formaldehyde. Antigenic strength and purity of the bulk toxoid is evaluated by measurement of ‘limit of flocculation’ (Lf) units….” “Due to its simplicity, speed and economy, flocculation remains the primary method used by vaccine manufacturers to evaluate toxin and toxoid concentrations in Lf.”

August 28, 2015 – WER No. 35 Vol 90 – Pertussis vaccines: WHO position paper (2015) – PDF, replacec Oct 2010 PP – HERE

• Recommendations on the use of pertussis vaccines were discussed by SAGE in April 2014 and in April 2015 – due to resurgance of pertussis in DTaP regions.
• Pertussis vaccines are used “in preventing severe pertussis in infants worldwide” i.e. the disease, not the spread!
• “It was estimated that that without vaccination there would have been >1.3 million pertussis related deaths globally in 2001.”
  • Referenced: Disease control priorities in developing countries. 2nd ed. New York, Oxford University Press/ The World Bank, 2006: Ch 20 Vaccine preventable Diseases 389–412 – PDF

2015 – SAGE: 2015 Assesment Report of the Global Vaccine Action Plan REPORT- PFD

• Decade of Vaccines half way point, Where are the unvaccinated people?
• “Coverage is hampered and only 30 to 40% of children are immunized against major childhood diseases. Inaccessible areas are home to more than half a million children still requiring catchup vaccination.”

2014

July 25, 2014 – WHO WER No. 30, Vol 89 – Revised guidance on the choice of pertussis vaccines – PDF

• ‘The efficacies of acellular pertussis vaccines (aP) and whole cell pertussis vaccines (wP) vary depending upon the case definition of pertussis used’
• “Protection against severe pertussis in infancy and early childhood can be obtained after a primary series of vaccination with wP or aP vaccine”
  • [Note: “protection” from “severe pertussis” is the objective of SAGE, as was stated in their 2010 position paper on pertussis vaccine. They know the the vaccines don’t stop colonisation of the bacterium and thus doesn’t stop transmission of the bacterium, yet they still promote more vaccines to get less sick and assume this means less transmission!]

May 23, 2014 – WHO WER No. 21, Vol 89 – PDF

• April 1-3, 2014 – SAGE meeting Geneva, Switzerland – thir report focused on (i) sustaining the momentum generated by the Decade of Vaccines (DoV)/Global Vaccine Action Plan (GVAP)…
• 40-year anniversary of the WHO Expanded Programme on Immunization (EPI) was celebrated during World Immunization Week, April 24–29, 2014
• The report emphasized that challenges remain to reach the milestone of 90% national coverage with 3 doses of diphtheria-tetanus-pertussis vaccine (DTP3) in all countries by 2015…
• Pertussis report: “The main outcome of the report is that pertussis vaccination is highly effective in reducing disease [i.e symptoms] caused by Bordetella pertussis, with a large decline in overall global incidence and mortality compared with the pre-vaccination era in both wP- and aP-using countries.”
  • Recent modelling studies from Australia, England and Wales, and the USA, as well as data from a baboon model, supported the hypothesis that wP to aP vaccine transition may be associated with disease resurgence”. …SAGE concluded that the shorter duration of protection and likely reduced impact on infection and transmission conferred by aP vaccines play critical roles.” Just vaccinate more!
  • [The baboon study shows wP and aP do not stop colonisation or trasmission. Baboons upon challenge transmitted and carried bacteria for 18 days (wP) versus 35 days (aP), compared to 30 days (unvaccinated first infection) all inferior to the sterilizing immunity provided by natural infection, where upon challeng immune baboon carried the bacteria for zero days – so why do SAGE still promote andy “infection and transmission” protction? – see pp. 321-327]
  • Vaccination of pregnant women is considered likely to be the most cost-effective complementary strategy to prevent pertussis-associated infant mortality”! SAGE believe “recent evidence suggests that maternal immunization with aP [DTaP not DTP] during pregnancy is safe and highly effective in protecting infants from pertussis and that it may have a high impact on morbidity and mortality in infants too young to have been immunized. More effective and favourable than cocooning.”
  • SAGE agreed that “cocooning” may have an impact on disease prevention – [the WHO actually referenced Wikipedia!]

2013

January 17-88, 2013 – WHO: Expert consultation on the use of placebos in vaccine trials – PDF

• “New and improved vaccines to prevent illness and death from infectious diseases are urgently needed, especially in low- or middle-income countries (LMICs)……” safety trials are done in randomized controlled trials but too often not with an inert placebo, but another vaccine product.

2012

WHO vaccine agendas take shape…

November 2012 – Pertussis resurgence: SAGE expressed concern about the apparent resurgence of pertussis in some industrialized countries despite high vaccine coverage with acellular pertussis (aP) vaccines which in some settings is associated with an increase in infant pertussis deaths. – REF (this is before the 2014 Baboon study showing aP creates super spreaders within a household – the first transmission study ever done!!!)

• SAGE then established a pertussis working group – “disease resurgence was defined as a larger burden of disease than expected when compared to previous cycles in the same settings”

May 25, 2012 – WHO WER No. 21, 2012, 87, 201–216 – PDF Vaccine Hesitancy, vaccines in pregnancy, mercury…

• “SAGE working group dealing with vaccine hesitancy has been established with a wide range of expertise and it will work over the next 12 months to generate recommendations on addressing vaccine hesitancy and its determinants”
• “SAGE noted that recent funding cuts in some countries may threaten the overall integrity of the immunization programme…”
• Global Polio Eradication Initiative (GPEI) – Wild polio virus type 2 was eliminated in 1999 [types 1 & 3 still circulating] but the continued use of tOPV contributes to ongoing type 2 vaccine-associated paralytic poliomyelitis and vaccine derived poliovirus outbreaks (cVDPV2). [The vaccine program is perpetuating “polio”.]
• “SAGE noted that the work on vaccine safety during pregnancy and lactation had been initiated and that the Global Vaccine Safety Initiative had been launched as the implementation mechanism of the Global Vaccine Safety Blueprint.”…SAGE recommended pregnant women as the most important risk group for inactivated seasonal influenza vaccination.” …”based on compelling evidence…”!!
• Influenza vaccine: “Health-care workers are recognized as a target group for whom vaccination would protect not only the individual but also vulnerable patients, and for whom a vaccination programme is an important element of infection control and pandemic preparedness.” [suggesting the vaccine stops colonisation and transmission???]
• “Increasing evidence demonstrates that [influenza] vaccines may be less effective in the elderly than in younger adults..” [Elderly were the target population, they’ve now switched to pregnant women and children, adults and healthcare workers i.e. everyone, because the vaccine is failing!]
  • “Successful introduction of influenza vaccines to healthy younger populations, including pregnant women and young children, would require educational programmes and social messaging.”[ catalyst for no jab no play policies from 2014, and no jab no pay from 2016?]
• “Information on vaccines for an Intergovernmental Negotiating Committee to prepare a global legally binding instrument on the use of mercury”
  • “WHO advised countries that mercury quantities in thiomersal-containing vaccines [multi dose vaccine vials] were extremely small, and if vials and syringes are handled in an environmentally sound manner as hospital waste, there would be minimal environmental release of mercury.” …replacement of thiomersal with an alternative preservative may affect the quality, safety and efficacy of vaccines; [and] re-registration would be required by the National Regulatory Authority”…There is insufficient existing manufacturing capacity to remove thiomersal and switch to single-use vials.” ..some products would be come unavailable i.e. DTP and Hep B
  • “SAGE reaffirmed that thiomersal-containing vaccines were safe, essential and irreplaceable components of immunization programmes, especially in developing countries…” [yet thiomersal has never been tested in a RCT for safety]

May 2012 – WHO 65th World Health Assembly – SAGE Global Vaccine Action Plan (GVAP) 2011-2020 (resolution WHA65.17) framework was endorsed, to help realize the vision of the Decade of Vaccines launched by Bill Gates in 2010 – REF, READ, UNICEF – READ

• GVAP is “a framework to prevent millions of deaths from vaccine-preventable diseases by 2020″
• “an immunization vision and strategy for the world for the decade 2011–2020.” – PDF
• “GVAP aims to strengthen routine immunization, accelerate control of vaccine-preventable diseases with polio eradication as the first milestone, introduce new vaccines, and spur research and development for the next generation of vaccines and technologies.” – REF

April 21-27, 2012 – The first World Immunization Week was celebrated in the 6 WHO Regions – REF

2011

January 7, 2011 – WER No. 1-2, Vol 86 – PDF

• SAGE reviewed the report and recommendations from the July 2010 Global Technical Consultation to Assess the Feasibility of Measles Eradication – they concluded that measles can and should be eradicated, based on 2 modelling studies!
  • From 2000 to 2008, an estimated 4.3 million additional measles deaths among children were averted as a result of increases in coverage of routine immunizations and implementation of measles SIAs.

2010

2010 – United Nations General Assembly Special Session (UNGASS) goals by 2010 – REF

• (i) Ensure full immunization of children under one year of age at 90% coverage nationally with at least 80% coverage in every district or equivalent administrative unit, (ii) Vitamin A Deficiency Elimination
• World Health Assembly (WHA) and UNGASS goals by 2005: (i) Polio Eradication, (ii) Measles Mortality Reduction, (iii) Maternal and Neonatal Tetanus Elimination (MNTE)
• Progress Towards Global Immunization Goals – 2012 – presentation slides – PDF

January 29, 2010 – BMGF: Bill and Melinda Gates Pledge $10 Billion in Call for Decade of Vaccines – ARCHIVE, GAVI celebrates 10 years – ARCHIVE, WHO – ARCHIVE, Bill Gates annual letter – ARCHIVE, WER – PDF

• “US$10 billion over the next 10 years to help research, develop and deliver vaccines to the world’s poorest countries sets a new precedent in global heath.” – REF

• “Increased vaccination could save more than 8 million children by 2020; significant funding gaps remain, others must join effort” [vaccines “save” 2-3 million in 2020]
• “As Bill and Melinda emphasised, we need look no further than GAVI’s first 10 years for living proof that immunisation is one of the most cost-effective ways to save children’s lives” – REF
  • “Despite these achievements…2.4 million children continue to die each year from vaccine-preventable diseases.”
• Important new vaccines for the two leading causes of global child deaths—severe diarrhea and pneumonia—are becoming available
• “As we build on that success, Bill & Melinda Gates’ call for a “decade of vaccines” represents the second time that the Gates Foundation is playing a transformational role in the delivery of life-saving vaccines to the world’s poorest countries” – REF
• “The Bill & Melinda Gates Foundation announcement comes on the tenth anniversary of the establishment of the Global Alliance for Vaccines and Immunization (GAVI). Dr Chan also congratulated the GAVI Alliance on their accomplishment of reaching 257 million additional children with new and underused vaccines.” – REF

January 2010 – (START) The WHO REFORM AGENDA traces back to “The future of financing for WHO – January 2010” – Timeline – “Landmark events of the WHO reform process from the initial consultation on the future of financing for WHO “-ARCHIVE, What is Reform – READ, 2014,

• Followed by 128th session of the Executive Board, January 2011

2006

2006 – WHO “Engaging for health” program covers the 10-year period from 2006 to 2015 – REF

January 6, 2006 – WER No. 1 Vol 81 – Conclusions and recommendations from the Immunization Strategic Advisory Group (SAGE) – PDF

• SAGE was updated on human papillomavirus (HPV) vaccines, disease burden and planning for vaccine introduction. …HPV infection is now designated a “necessary” cause of cervical cancer, the second most common cancer in women,…disease burden varies enormously between countries, as do age-group patterns of infection” Of 2 candidates “Both vaccines appear to be safe and effective” but “positive impact of the intervention will only be observed after a considerable number of years,…” they have no idea!
• “SAGE noted that while these vaccines might be promoted as cancer-preventing products, [??] additional promotion as vaccines against a sexually transmitted infection may foster negative connotations as some groups may perceive their use as encouraging promiscuity.”
• “SAGE recognized that the introduction of HPV vaccine could serve as a model for one of the Global Immunization Vision and Strategy (GIVS) objectives of vaccinating age groups other than infants, notably school age children and adolescents. This model could also provide an entry point for the introduction of HIV vaccines in the future.” !!
• A “strong political commitment would be required for the introduction of these vaccines”…!
• “More than 20 years have passed since the “EPI schedule” of 6, 10 and 14 weeks for DTP-OPV and 9 months for measles vaccine was introduced, and more information has accrued, together with the development of improved techniques for assessing immune responses” [~1986]. Immunization schedules in use today vary greatly around the world, and it is unlikely that a single, uniform immunization schedule would suit all countries”

2005

International Health Regulations (2005) adopted, and the call for strengthening Influenza Pandemic Preparedness, WHO SAGE changes focus to Everything Global Immunization

2005 – WHO Technical Report Series: WHO EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION – PDF

• “The production and control of conjugate vaccines is more complex than that of their unconjugated capsular polysaccharide counterparts. Polysaccharide vaccines consist of defined chemical substances that if prepared to the same specifications, can reasonably be expected to have comparable potencies” (pg 68) [so not biological material?]
• Includes definition for GMO, Immunogenicity, Potency, Primary vaccination etc but not what defines a “vaccine”
• “Many vaccines are produced using prokaryotic or eukaryotic microorganisms and subtle changes in these organisms may radically affect the vaccine product…”

November 9-11, 2005 – WER No 1, 2006 81, Pg 1-12: Conclusions and recommendations from the Immunization Strategic Advisory Group – SAGE (which was formed1999) is now restructured to oversee all aspects of Global Immunization – PDF,

• The “new structure to make SAGE more relevant to WHO in formulating global immunization strategies and policies in the light of the Global Immunization Vision and Strategy (GIVS)
• “SAGE will report to the Director-General on issues ranging from vaccine research and development to immunization delivery, and extending beyond childhood immunization to all vaccine-preventable diseases. SAGE would therefore evolve into a body overarching global immunization.”
• Other key immunization related WHO advisory committees that report to SAGE:
  • Global Advisory Committee on Vaccine Safety (GACVS)
  • Expert Committee on Biological Standardization (ECBS)
  • Steering Committee of the Immunization Safety Priority project (ISP)
  • Initiative for Vaccine Research Advisory Committee (IVRAC)
  • Advisory Committee on Polio Eradication (ACPE)
    
• UNICEF and WHO’s Global Immunization Vision and Strategy (GIVS) document finalised focused on 4 strategic areas:
  • Protecting more people in a changing world – i.e. scaling up of routine vaccination activities for “child survival”
    • “..the political commitment to immunization was pivotal in reaching high coverage and in maintaining services as a keystone of integrated primary health care”
  • Introducing new vaccines and technologies
  • Integrating immunization, other linked interventions and surveillance in the health systems context
    • “SAGE suggested that the GIVS research agenda be expanded beyond clinical trials to include other areas of research, such as health systems research, acceptability and community preparedness studies, epidemiological studies and cost-effectiveness studies.” [infiltrate every part of “health” care]
  • Immunizing in a context of global interdependence [OneHealth?]
• The [2005] current global production capacity for seasonal influenza vaccines was 300 million doses per year of trivalent vaccine. …Manufacturers are considering a variety of strategies to increase the global production capacity…” [for vaccination pandemic influenza preparedness – in time for 2009 pandemic?!]
  • One way to increase preparedness capacity is by “increasing use of seasonal vaccine thereby increasing vaccine production capacity.” to extend coverage to 75% but “relies on implementation of influenza vaccination policies”! [so the flu vaccine push by 2012 into everyone’s arm…was actually to increase manufacture capacity in the name of “pandemic preparedness”] As per May 2005 WHA resolution
  • SAGE push for ALL countries develop pandemic preparedness plans that include strategies for the deployment of vaccines when these become available. <50 countries had plans at this time.
  • “SAGE stressed that countries must not depend solely on vaccines for pandemic control because lack of vaccine or at best shortage will be a reality in most countries.” [Wow! How that changed in 2020, the focus was directed to a vaccine with a brand new, never tested technology product which the global regulators just happened to have a fairly recently established “fast track” emergency pathway!]
• SAGE was briefed on current research and development on rotavirus vaccines by multinational companies and “emerging” manufacturers and more specifically on the current development, licensing and plans for 2 vaccines: Rotarix and RotaTeq [the latter by Dr Paul Offit and Stanley Plotkins et al]

October 24-28, 2005 – WHO 56th meeting of Expert Committee on Biological Standardization: Guidelines for Assuring the Quality and Non Clinical Safety Evaluation of DNA vaccines – PDF, SOURCE

• “Vaccination involves priming the immune system of a host with an infectious agent or components of an infectious agent modified in a manner to assure that the vaccine does not cause any harm or disease to the host, but ensures that when the host is confronted with that infectious agent, its immune system can adequately control the invading organism before it causes any ill effect”
• A radically new approach to vaccination has been actively and vigorously developed since early 1990’s. This involves the direct introduction of plasmid DNA containing the gene encoding the antigen against which an immune response is sought into appropriate host tissues and the in situ production of the target antigen(s).
• Similarly, many aspects of the guidelines may be applicable to vaccines based on RNA…”

June 12-15, 2005 – Pan American Health Organisation: Sixth Annual Global Vaccine Research Forum in Salvador da Bahia, Brazil – “Cutting-edge Science on New Vaccines: Global Forum to Cover Latest Developments, Key Challenges”- READ, CREDIT

• “Major breakthroughs are occurring in the development of new vaccines. There are about 20 vaccines currently in use; an equivalent number of new or improved vaccines is anticipated within the next ten years.”
• “These vaccines will be a relatively inexpensive health intervention with a significant public health impact; however, they will cost more than vaccines in current use. WHO Member States last month adopted a resolution on a new Global Immunization Vision and Strategy, an important component of which is introducing new vaccines”
• Prospects for new vaccines against pandemic avian influenza, Acceleration of life-saving rotavirus, pneumococcal and meningitis vaccines…
• The Pan American Health and Education Foundation is a U.S. not-for-profit philanthropic organization that enjoys a unique partnership with the Pan American Health Organization based on our shared vision of health for all – REF, List of topics covered – HERE Formally the 1902 Pan American Sanitary Bureau – ARCHIVE

May 23, 2005 – WHO: 58th WHA – new International Health Regulations (IHR) are unanimously adopted by WHO Member states – ARCHIVE, REF, REF2, TIMELINE

• IHR are a “tool in the fight against the global spread of infectious disease” – IHR are “rules that countries must follow to identify disease outbreaks and stop them from spreading” i.e. member states are bound by international laws
• 2003 – WHO Department of Communicable Disease Surveillance and Response (CSR) is working towards global health security – epidemic alert and response (Epidemic and Pandemic Alert and Response) – ARCHIVE

May 16-25, 2005: WHO: 58th WHA resolution WHA58.5 called for the “Strengthening pandemic-influenza preparedness and response.” – REF

2004

2004 – The Global Health Histories initiative was established by WHO in late 2004 – 2006, 2010

• History is very important because all major contemporary policy declarations have historical sections. Historical analyses are being used to justify contemporary agendas. The historian working in tandem with policy managers has and important role to play. Even when you look at recent recent pronouncements about the need to increase immunization coverage, you have references to the lessons learned from the global smallpox eradication program. You cannot learn lessons unless you understand the complex history of that program – says Dr Sanjoy Bhattacharya, Director, Centre of Global Health Histories – (download) – WATCH
  • WHO smallpox eradication program – ARCHIVE
    [What if the “official” history of smallpox eradication is a lie? – CONSIDER ]
• Presentations 2005-2007, 2005-2014,
• PUBLICATION: The Third ten years of the World Health Organization (1968-1977) – PDF, ARCHIVE
  • This is first new publication within the global health initiative. It is a sequel to the previous two volumes published in 1958 and 1968, during the 20-year tenure of Dr Marcolino Candau as Director-General, first elected in 1953, then 3 more times.
  • A new phrase entered the text of the second volume published 1968, namely ‘smallpox eradication’.

2003

2003 – WHO Dept V& B: Vaccines and Biologicals Catalogue 2003 -Lists documents produced and distributed by the World Health Organization’s Department of Vaccines and Biologicals (V&B) since its establishment in 1998 – PDF, SOURCE co signed Gro Harlem Brundtland

2003 – WHO – Laboratory Safety Manual – PDF, SOURCE

• “This specialized agency of the United Nations published the first edition of its Laboratory biosafety manual in 1983” Biosafety Lab Levels 1-4
• “Recombinant DNA technology involves combining genetic information from different sources thereby creating genetically modified organisms (GMOs) that may have never existed in nature before.”…concern resulted in the famous Asilomar conference held in 1975, where the first guidelines for recombinant DNA technology were proposed. (pg 52) – TIMELINE

2002

November 26-28, 2002 – WHO/IVR: Ethical considerations arising from vaccine trials conducted in paediatric populations with high disease burden in developing countries – PDF

• CLAIM: “Each year, millions of children in developing countries suffer from infectious diseases. Of these, more than 2.7 million children under five (WHO 2001 estimate) die from diseases that are potentially [no guarantee] preventable by vaccines.
  • [This is an important claim which is parroted by WHO yet supply without citation]
• In light of these unacceptable [estimated!] rates of morbidity and mortality, the development or improvement of vaccines to meet the needs of children in developing countries continues to be one of the highest priorities, with the attendant requirement for an increasing number of trials to evaluate new vaccines.”
• A cautious approach is appropriate in the conduct of vaccine trials among children in any circumstances because of their particular vulnerability in view of their inability to give informed consent and their sometimes greater potential to adverse reaction to vaccines.”

October 2002 – Global Health Security | Epidemic Alert & Response: “WHO Guidelines on the use of Vaccines and Antivirals during Influenza Pandemics” (first draft) – ARCHIVE, PDF, WER 2005 CREDIT

• Grew out of the July 2001 Global Agenda on Influenza Surveillance and Control, which then “In May 2002, WHO convened a consultation of influenza experts, virologists, epidemiologists, public health officials, and representatives of the pharmaceutical industry to debate and finalize the world’s first global agenda on influenza surveillance and control”
• “Vaccination is the primary means of preventing influenza…Immunity is typically produced after a period of two to three weeks following a single vaccine dose when the viruses contained are ones to which the vaccinees have had past experience…” [immunity!]
• Inactivated influenza vaccines similar to those currently in use were first introduced during the 1940’s [Francis (1945)]. Since that time, they have been improved in terms of their standardization and purity.”

May 2002 – The world’s first Global Agenda on Influenza Surveillance and Control was finalised – REF

• The WHO Global Influenza Programme, “in response to growing recognition that more needs to be done in preventing, monitoring and controlling influenza worldwide” called for proposals “in a spirit of collaboration” beginning July 2001. “WHO has sought to raise the profile of influenza as an important public health threat having significant economic as well as health consequences throughout the world.”
• In May 2002, WHO convened a consultation of influenza experts, virologists, epidemiologists, public health officials, and representatives of the pharmaceutical industry to debate and finalize the world’s first global agenda on influenza surveillance and control”

2002 – WHO: State of the World’s Vaccines and Immunization – jointly released by WHO, UNICEF and the World Bank, charts the many issues surrounding vaccines and immunization in 2002 includes “arguing the power of vaccines and immunization as an effective public health intervention” – PFD [Setting the ground work for ramping up the vaccine agenda]

• Document highlights the immense strides made in global immunization since the mid-1990s.
• “Imagine a world without vaccines. Life-threatening diseases would present a daily risk… We would live in fear of deadly strains of diphtheria, tetanus and measles; polio would be a constant danger and in a matter of hours could paralyse a child, and smallpox would continue to scar and kill.” [Wow! someone should introduce the WHO to Dissolving Illusions!]
• “Immunization, as powerful and successful as it is, has yet to reach its enormous potential. One-quarter of the world’s children still have no protection from common preventable diseases. Nearly 3 million people (2 million of them children) die every year from those same killers. Children in developing countries are dying from other diseases, such as meningitis and pneumonia, while vaccines for these are widely used in the industrialized world.” …”The right to protection from preventable diseases is the right of every child and it is well within our collective capacity to realize that right.”
  • [Another bold mortality claim with NO citation for how they came up with these numbers!]
• Smallpox was eradicated in 1979, polio is about to be eradicated [wrong] and about two-thirds of developing countries have succeeded in eliminating neonatal tetanus.
• But global commitment to immunization has not been sustained in all developing countries! By 2000, about 37 million children worldwide missed out on routine immunization during their first year of life…Today, the divide in access to vaccines and immunization continues to undermine the principle of equity on which national immunization programmes should be based.”…global immunization coverage of over 70% was sustained throughout the1990s…”
• “Despite the overall success of immunization programmes, almost 11 million children under five years of age die each year.” [Seriously they are just making up these numbers, it was 2.7 million in 2002]
• “In sub-Saharan Africa, for example, deaths among children under five almost doubled over the past four decades from 2.3–4.5 million a year”…Millions more children are growing up with no protection against some of the life threatening, disabling and vaccine-preventable diseases of childhood.” [EVERYTHING is vaccines!]
• …”lack of demand for a new vaccine at the outset can have a long-term impact on both the supply and price” – [and there you have it folks, need to keep creating demand!]

• “There are many reasons why the world community should invest in immunization and the reduction of infectious diseases. They include not only public health reasons but also humanitarian, economic and social reasons.”
• “While the market for vaccines in developing countries is potentially vast – including the 132 million children born each year – they currently account for only 18% of the global US$6 billion vaccine market.”
  • “The global vaccines market size is projected to grow from $78.27 billion in 2023 to $122.27 billion by 2030, at a CAGR of 6.6% during the forecast period” – REF

2001

2001 – WHO Department of Vaccines and Biologicals – Biennial Report 2000-2001 –PDF

• GAVI was launched and changed the international vaccination stage

2001 – WHO “IMMUNIZATION systems are stagnating. Many countries that were dramatically successful in raising
their immunization coverage in the 1980s are now finding it difficult to lift coverage rates from 50% up to a target of at least 80%.” – REF

2000 – The Year of vaccine ramp up

December 2000 – WHO Technologies for vaccine delivery in the 21st century (Syringe, needles and storage) – PDF

• Sponsored by PATH etc

October 26-27, 2000 – Report of the second meeting of the Steering Committee on Immunization Safety (SCIS), Geneva – PDF (sponsored in part by Bill and Melinda Gates Children’s Vaccine Program (CVP))

• Up to 1/3rd of immunization injections today are not carried out in a way that guarantees safety.

September 2000 – UN Millennium Summit held in New York in – set the eight Millennium Development Goals (MDGs) – REF

• “The fourth goal, to reduce child mortality, has the specific target of reducing under-five mortality by two-thirds between 1990 and 2015. One of the specific indicators to measure progress towards the goal is the proportion of one-year-old children immunized against measles.” !

June 13, 2000 – WHO V&B: Networking for new vaccine evaluation – examine ways of helping national regulatory authorities (NRAs) to evaluate clinical data generated in support of vaccine licensing – led by TGA’s Dr John McEwen [i.e. Training the regulat -ors for the anticipated influx of vaccines] – PDF

June 11-12, 2000 – WHO Dept Vaccines and Biologicals (V&B): Report of the Strategic Advisory Group of Experts (SAGE) -their second meeting – PDF, SOURCE

• Accelerated vaccine introduction (AVI) of 1999, thanks to funding via the new entity GAVI – The aim of the project is to find and apply, by 2003, mechanisms for speeding up the introduction into developing countries of new and underused vaccines that could be of public health importance in these countries.”…”Major barriers include a lack of adequate financing, the absence of satisfactory data on vaccine efficacy and cost-effectiveness, and on the burden of vaccine target diseases, and the need for technical assistance on logistics, supply and quality control.”
• “SAGE believes vaccine and immunization safety to be one of the most important issues that the vaccine community faces. A major catastrophe that could have been prevented by timely, appropriate action could destroy the whole vaccine edifice. SAGE therefore strongly supports efforts to develop efficient, continuous monitoring systems and sound scientific evaluation systems, with a view to anticipating the occurrence of vaccine-related adverse events“
• “SAGE urges WHO to be in close touch with all the other players involved in the introduction of new vaccines, most specifically those that are devoting funds to vaccine introduction initiatives, such as the Bill & Melinda Gates Children’s Vaccine Program [Private] and the International Vaccine Institute, and also the vaccine industry, which is strongly promoting the development of new vaccines.”
• In light of GAVI’s introduction in 1999 – “SAGE would, as a result, have to assume a new role in a new universe – a universe in which for the first time the vaccine and immunization scene would benefit from significant financial resources, thanks to the influx of funding that attended the birth of GAVI.”
• “There has also been a change in the role of SAGE, as reflected in its designation as a “strategic” rather than purely “scientific” group of experts. This change denotes a broader definition of the scope of SAGE, which no longer focuses only or primarily on vaccine research and development but now encompasses the whole spectrum of V&B activities”

June 7-9, 2000 – WHO Proceedings of the first Global Vaccine Research Forum, Montreux – PDF

• Creating incentives for industry to invest in developing market vaccines: role of public sector in forging partnerships with industry

February 2000 – Bulletin of the World Health Organization, 2000; 78(2): 153-231 (Reprint); Immunization safety: a global priority – PDF

• In 1999 the Immunization Safety Priority Project (ISPP) began where by 2003 the WHO will establish a comprehensive system to ensure safety
• “When WHO began its immunization programmes in 1974, less than 5% of the world’s children were immunized. Twenty-five years later, the figure stands at about 75%….
• “Adverse events following vaccination (AEFI) range from the common, innocuous redness and soreness at point of injection, to rare, serious conditions such as the potential risk of a severe allergic reaction in 1:100,000 to 1:1,000,000 doses of measles vaccine.” [no citation was provided]

March 16-17, 2000 – Report of a meeting of international public sector vaccinology institutions – PDF, SOURCE

• Prioritizing vaccines for the developing world- “The priority vaccines of the WHO Intercluster Vaccine Research Initiative (IVR) include HIV, malaria, tuberculosis and specific developing market vaccines which have yet to be selected”
• Pilot production issues for parasitic vaccines – As there are currently no vaccines against parasites for human use [Could ivermectin actually be considered a oral ‘parasitic vaccine”, in that it is a biological, derived from an organism??]
• “The group stated the importance of combination vaccines for the immunization programmes in the developing world, their impact on the operational costs and associated safety issues.” with “Ongoing work to produce combination vaccines (DTP–HepB–Hib, measles/JE, MMR/varicella)”!!!

January 2000 – GAVI: A new multi-million dollar Global Fund for Children’s Vaccines (the Fund) was launched by the GAVI partners – Press Release – ARCHIVE

• “Enabled by a generous gift from the Bill and Melinda Gates Foundation ($150 million per year for five years, This is the largest gift in the Foundation’s history [It’s one month old!]), the Global Fund for Children’s Vaccines has been created by GAVI to help fill the gaps that currently prevent the immunization of each and every child against major diseases.” –REF

January 31, 2000 – The Global Alliance for Vaccines and Immunisation (GAVI) is launched – TIMELINE

• Sponsored by BMGF and launched a the WEF.
• “Since 2000, the GAVI partners have been targeting assistance to the poorest countries through the Vaccine Fund to help them boost coverage with existing vaccines, improve immunization systems (including injection safety) and introduce under-used vaccines, including hepatitis B, Hib and yellow fever” (2003)- REF
• “The culture of disease prevention gained momentum in the biennium, particularly through” the impressive debut of the Global Alliance for Vaccines and Immunization (GAVI)” – REF
• “The advent in 2000 of the Global Alliance for Vaccines and Immunization (GAVI) and of the Vaccine Fund have brought immunization back to the top of the international public health agenda.“- REF

1999

November 1999 – WHO Dept V&B: Study of donor inputs to vaccine production – PDF

• In 1991 studies were begun of the characteristics of local vaccine production (produced within a country for use in that country, generally in a public sector facility) in developing countries under the auspices of the Children’s Vaccine Initiative.
• WHO is now poised to play an enhanced role in ensuring access to new vaccine and immunization-related technologies, through
  • (1) strengthening national regulatory authorities;
  • (2) promoting local production viability; and
  • (3) facilitating access to patent-protected technologies.

November 15-16, 1999 – WHO Dept V& B: Report of a meeting on health sector reform and priority health interventions: the case of immunization services – PDF

• “A substantial number of countries have embarked upon, or are in the process of planning fundamental changes in their health systems – health sector reform – to respond more adequately to the needs of local populations as well as to other challenges from the socioeconomic and political environment” [Really?]
• “The meeting was organized to take stock of the interrelationship between health sector reform and immunization services” which are said to be a means of “strengthening health systems” and “Immunization services performance is an excellent indicator of the performance of the overall health system”!

November 4-5, 1999 – Assessing the global needs for vaccine research and development. Results of a Joint GAVI/WHO meeting, Geneva w/ co-chairs GAVI, Aventis-Pasteur and GmithKlein Beecham – PDF, SOURCE

• “Recognising that “Accelerating the research and development efforts for vacciens and related products specifically needed by developing countries, particularly vaccines against HIV/AIDS, malaria and tuberculosis” is one of the fundamental objectives of the Global Alliance for Vaccines and Immunization, the purpose of this “pre-Task Force” on R&D”
• Meeting co-sponsored by the Intercluster Vaccine Research Initiative of the WHO

November 1-3, 1999 – Report of the Strategic Advisory Group of Experts (SAGE) with in WHO Dept Vaccines and Biologicals (Published March 2000) – PDF, SOURCE, GPV document ARCHIVE, ARCHIVE

• Report from the FIRST meeting of the SAGE (with”S” for “Strategic”, no longer “Scientific”) established by Dr Gro Harlem Brundtland, the Director-General of the World Health Organization in 1999 – TIMELINE
• “Report was funded by unspecified donors!”The Department of Vaccines and Biologicals thanks the donors whose unspecified financial support has made the production of this document possible” [Hmmm!]

August 1999 – WHO | Access to Technologies Team of the Department of Vaccines and Other Biologicals: Regulation of vaccines: building on existing drug regulatory authorities – PDF

• Although vaccines are generally included in the legal definition of pharmaceutical products, and thus would fall under the jurisdiction of drug regulatory authorities (DRAs), there are extra considerations that apply to their regulation and control.” …
• “Vaccines provide one of the most cost-effective of all public health interventions and are among the safest medicinal products.”
• “Vaccines differ from therapeutic medicines first because of the biological, and thus inherently variable nature of the products themselves, the raw materials used in their production, and the biological methods used to test them. Thus special expertise and procedures are needed for their manufacture, control, and regulation.” They are “usually administered to very large numbers of healthy people, mostly infants, in national immunization programmes; thus safety and quality are paramount.”
• New vaccines are being developed at a rapid pace and these vaccines will represent new and complex challenges for regulatory authorities as well as for vaccine manufacturers – i.e. conjugate vaccines and new DNA vaccines
• What are the essential features of a regulatory system for vaccines?
  • Because of the special biological nature of vaccines, all 6 vaccine regulatory steps need to be followed, which includes the distribution and storage be well supervised, down to the end user.
  • Staff expertise required for “areas of assessing the documentation for marketing authorization, Good Manufacturing Practice (GMP) inspections, and authorization and evaluation of clinical trials on vaccines.
  • …due care should be exercised to ensure that the characteristics of the product which will be proposed for licensing are the same as those of the product which will be tested in humans” [They failed this step for COVID-19 Pfizer mRNA from Process 1 to Process 2]
• This means that associations supporting causality will be difficult to establish or rule out.

June 1999 – WHO: Options for a Global Fund for New Vaccines – PDF

• “Currently, a Global Fund for New Vaccines is being put forward as one possible part of a system for expanding and improving vaccination…” Exploring the five parameters of: equity, impact, feasibility, sustainability and scope. “Investment of fund capital is expected to provide returns of approximately 8% per year”.
  • GAVI/BMGF to the rescue with Jan 2000 with the launch of the Global Fund for Children’s Vaccines, – ARCHIVE

1999 – WHO – Strategic Advisory Group of Experts (SAGE) on Immunization was established by the Director-General of the World Health Organization in 1999 to provide guidance on the work of WHOs Department of Immunization, Vaccines and Biologicals (IVB). – ARCHIVE, ARCHIVE2 , REF

• The Terms or reference of the Group were revised during 2005 in view of the development of the Global Immunization Vision and Strategy (GIVS).
  • Note the word “Strategic AGE” versus “Scientific AGE, yet both use acronym SAGE
• SAGE is the principal advisory group to the WHO for vaccines and immunization, for all vaccine-preventable diseases. It provides guidance on the work of the Department of Immunization, Vaccines and Biologicals (IVB). SAGE meets annually – REF
• SAGE is charged with advising WHO on overall global policies and strategies, ranging from vaccines and technology, research and development, to delivery of immunization and its linkages with other health interventions.
• SAGE has multiple Working Groups – EXAMPLE
• SAGE membership can include representatives of the Bill and Melinda Gates Foundation (BMGF) a WHO major sponsor, such as in 2013 Dr Steve Landry, Deputy Director of Global Health Program, Bill & Melinda Gates Foundation – ARCHIVE
• SAGE compose and release “Vaccine Position Papers” to provide recommendations to member states on vaccination – ARCHIVE, ARCHIVE2, all ARCHIVES, 2007 first – ARCHIVED, 2015 – ARCHIVE, 2022 – ARCHIVE
  • Example Chickenpox vaccine 1998 – PDF
    • “Varicella (chickenpox) is an acute, highly contagious viral disease with worldwide distribution. While mostly a mild disorder in childhood, varicella tends to be more severe in adults. It may be fatal, especially in neonates and in immunocompromised persons.”
• WHO recommendations for routine immunization – ARCHIVE, 2016 – ARCHIVE

January 21- 22, 1999 – WHO: | Department of Vaccines and Other Biologicals: Review of existing documents on planning, performance and assessment of clinical studies on vaccines – PDF

• Vaccines are a “special group of pharmaceuticals has distinct features that should be taken into consideration in planning, performance and assessment of clinical studies”
• “Many vaccines are intended for use in, and clinical studies in children necessitate especially careful planning and a thorough assessment of the risk–benefit ratio”
• The “most important internationally adopted documents covering the ethical aspects of biomedical research on human subjects”
• Control groups or “comparator may be either active or a placebo”

In 1999 – Bill Gates began to reposition his brand from computer geek monopolist to public health and education “philanthropist” by forming the Bill & Melinda Gates Foundation (BMGF) which officially launched in January 2000 –TIMELINE

1998

June 9-11,1998 – Report of the meeting of the Scientific Advisory Group of Experts (SAGE) – a joint Children’s Vaccine Initiative (CVI) and Global Program for Vaccines and Immunization (GPV) report – PDF

• “…thanks the donors whose unspecified financial support in 1997 has made the production of this document possible” [How can this group of experts be trusted as “independent” if funding sources are unknown with possible conflicts of interest?]
• This report is the result of “The third formal meeting of the Scientific Advisory Group of Experts (SAGE) for the Children’s Vaccine Initiative (CVI) and the Global Programme for Vaccines and Immunization (GPV) was held in Geneva on 9-11 June 1998″
  • Terms of Reference of the Joint CVI and GPV Scientific Advisory Group of Experts (SAGE) – Page 72
• Note this Scientific Advisory Group of Experts “SAGE” is the prelude to WHO Strategic Advisory Group of Experts (SAGE) on Immunization, both with the same acronym! – TIMELINE

January 30, 1998 – WHO Department of Vaccines and Biologicals went online, formally known as the Global Programme on Vaccines and Immunization – ARCHIVE

1997

November 1997 – WHO: The Children’s Vaccine Initiative (CVI) Strategic Plan: managing opportunity and change : a vision of vaccination for the 21st century – READ, PDF The first strategic plan was 1992-93

• Published jointly by CVI, UNICEF, UNDP, World Bank, WHO and Rockefeller Foundation
• “global eradication of polio is now within immediate reach” – [they got that wrong again, but is good for marketing]
• CREDIT: Manufactured Consent (not infomed consent) by Suzanne Humphries, it started with this vision document – WATCH

1996

March 1996 – WHO: Global Programme for Vaccines and Immunization: Expanded Programme on Immunization (EPI) – PDF

• The first edition of the EPI document “Immunization Policy” was published 1986 which began by targeting “vaccine coverage”
• By 1996 “the EPI has changed its focus to the control or elimination of major childhood diseases, and new vaccines have become available, while yet others are being developed.”
  • “The EPI recommends that all countries immunize against poliomyelitis, diphtheria, pertussis, tetanus and measles, and that countries with a high incidence of tuberculosis (TB) infection should immunize against TB.”
  • Table 3.Vaccine efficacy and vaccine-induced immunity
  • Basic immunization schedules and strategies
  • Figure 1: Expected duration of immunity after different immunization schedules

• Also found in side the document:
  • Table 3.Vaccine efficacy and vaccine-induced immunity
  • Basic immunization schedules and strategies
  • Figure 1: Expected duration of immunity after different immunization schedules
  • Until recently, the EPI has not addressed the issue of booster doses of EPI vaccines (EPI 1993e). The first priority has been to ensure that infants are completely immunized against target diseases at the youngest age possible – only consider boosters when coverage >80%!
  • Table 9.Percentage of countries using different immunization schedules for DPT vaccine
  • Reactions following immunization – “modern vaccines are safe”, blame most reactions on needles not being sterilized properly!

1995

June 12-14 – 1995 – WHO Vaccine R&D (VRD) Global Programme for Vaccines and Immunization (GVP) – SAGE: 1995 Progress Report & Plan of Activities for 1996 (WHO/VDR/GEN/95.03) – PDF

1993

1993 – WHO Immunological Basis for Immunization – Module series developed by WHO/EIP to answer questions from the field – Initially started with 8 modules- REF

• Module 3 – Tetanus – READ
• Module 4 – Pertussis – READ
• Module 10 – Chicken Pox – READ

1992

1992 – WHO | 45th WHA – Global Programme for Vaccines and Immunization – GPV Policy Statement on vaccine quality – resolved that all vaccines used within national immunization programmes meet WHO requirements (WHA45.17), thus reinforcing these guidelines as a credible goal for all countries – PDF

1990

September 29-30, 1990 – United Nations World Summit for Children – largest gathering of world leaders ever- READ, WIKI

• The Declaration on the Survival, Protection, and Development of Children was endorsed
• First Call for Children: World Declaration and Plan of Action from the World Summit for Children – Conventions of the Rights of the Child – a person under 18 years – PDF
• Childrens Vaccine Initiative (CVI) was launched

May 1990 – World Health Assembly set measles vaccine goal – REF

• “Reduction by 95% in measles deaths and reduction by 90 per cent of measles cases compared to pre-immunization levels by 1995, as a major step towards the global eradication of measles in the longer run”.

1989

1998 – UN Foundation : UN Human Rights Convention, The Convention on the Rights of the Child, was adopted unanimously by the United Nations General Assembly in 1989 – REF,

• “The Convention breaks new ground in international law by legitimizing the needs of children, and outlines the minimum requirements for their legal and physical well-being. In particular the Convention defines the rights of all children to healthy and productive lives.” [vaccines = “health” to UN/WHO]
• The United Nations Children’s Fund (UNICEF) is the only UN agency exclusively dedicated to children’s issues, including children’s health. It “helped to marshal international policy agreements on behalf of children. Most notable is the Convention on the Rights of the Child” One of UNICEF’s “primary missions consists of preventing and treating childhood illness and death.”

May 1989 – WHO: 42nd World Health Assembly set the agenda for the Expanded Programme on Immunization (EPI) in the 1990s. – REF

• Challenges included the reduction of measles incidence and elimination of neonatal tetanus by 1995, global eradication of poliomyelitis by the year 2000, and the achievement of 90% immunization coverage for all vaccines by the year 2000.

1986

1986 – WHO: Global Programme for Vaccines and Immunization: Expanded Programme on Immunization (EPI) document “Immunization Policy” – which was used as “a basis for immunization programmes throughout the world.” – REF – Setting targets for “vaccine coverage” by 1990.

• In 1986 “… many programmes were in the early stages of development and global goals referred to the achievement of coverage targets” By 1996 the EPI focused on control of elimination of major childhood diseases

1983

1983 – A New Pandemic emerges HIV/AIDS- Much of the world’s optimism about the state of health was shattered by a new, mysterious pandemic, HIV/AIDS. In Australia, the virus was first identified in a patient in Sydney in 1983 – REF, REF

1983 – The First edition of Laboratory Biosafety Manual was published in 1983 – REF, SOURCE

• “The manual encourages countries to prepare specific codes of practice for the safe handling of pathogenic microorganisms in laboratories within their geographical borders, and provides expert guidance for developing such codes of practice.”

1981

1981 – WHO: World Health Day with the ‘Health for all by the year 2000‘ – REF

1981 – Vaccines available in 1981 – REF

1980

1980 – Because of 1974 EPI extensive training program, by 1980 “almost every country in the world adopted the principle of a national immunization programme – on the back of 6 vaccines – REF

1980 – WHO declared smallpox eradicated – now then need a new enemy to targed

• Somewhere in our history “vaccine” and “vaccination” has come to mean something very different to it’s original definition
  • Vaccine = cow (vacca) pox inoculation to ward of smallpox
  • Vaccination = Coined by Edward Jenner for the act of “vaccine inoculation to ward of smallpox”

1979

December 9, 1979 – Global Commission for Certification of Smallpox Eradication – sign parchment at Geneva – Archives of the Smallpox Eradication Programme –ARCHIVE, WHO Smallpox – 2014

• “The last known natural case was in Somalia in 1977. Since then, the only known cases were caused by a laboratory accident in 1978 in Birmingham, England, which killed one person and caused a limited outbreak. Smallpox was officially declared eradicated in 1979 ” FAQ – ARCHIVE
• “When smallpox was officially certified as eradicated, in December 1979 an agreement was reached under which all remaining stocks of the virus would either be destroyed or passed to one of two secure laboratories – one in the United States and one in the Russian Federation. That process was completed in the early 1980s and since then no other laboratory has officially had access to the virus which causes smallpox.” – REF
• In 1980 the 33rd World Health Assembly endorsed the conclusions of the Global Commission for Certification of Smallpox Eradication that smallpox had been eradicated worldwide and that the return of the virus was unlikely – REF
• Smallpox is now a disease covered under WHO Global Alert and Resonse (GAR) – REF, originally Communicable Disease Surveillance and Response (CSR) – ARCHIVE

1978

September 12, 1978 – International Conference on Primary Health Care, in Alma-Ata, Kazakhstan sets the historic goal of “Health for All” – REF, TIMELINE

1977

1977 – The first Essential Medicines List appeared in 1977, two years after the World Health Assembly introduced the concepts of “essential drugs” and “national drug policy” – REF

1974

May 23, 1974 – WHO launch of the Expanded Programme on Immunization (EPI) – all the world’s children should receive 6 vaccines – TIMELINE, REF, REF2, 50 year anniversary in 2024 – READ

• “Following the impressive success of the smallpox eradication programme, the World Health Organization looked for other activities that could build on what had already been achieved. In 1974 the Expanded Programme on Immunization  was created. “Expanded” because most programmes until then had only used smallpox, BCG and diphtheria, tetanus and pertussis (DTP) vaccines. EPI would include two new diseases. The six diseases chosen were tuberculosis, diphtheria, neonatal tetanus, whooping cough, poliomyelitis and measles.” – WHO History of Vaccines – REF
• “Selection was made on the basis of a high burden of disease and the availability of a well-tried vaccines at an affordable price. “Expanded” also meant increased coverage – incredibly, less than 5% of children in developing countries were being reached at that time by immunization services.” UNICEF and Rotary International partnered with EPI
• “Building on the momentum of the smallpox eradication effort, EPI was initiated with the goal of providing universal access to life-saving vaccines for children worldwide…” And so begins the mass, systematic “inoculation” program
• The programme developed training materials and disseminated them widely.  By 1980 “almost every country in the world adopted the principle of a national immunization programme.” – REF
• It is claimed in 1974 when WHO started its immunization services less than 5% of the world’s children were immunized. 25 years later, the figure stands at about 75% – REF
• By 2024 the WHO recommends 13 vaccine antigens, including COVID-19 – REF

1969

July 25, 1969 – Twenty-second World Health Assembly adopts “a revised and consolidated version of the previous International Sanitary Regulations” renamed the International Health Regulations (1996) – WHA – ARCHIVE, IHR – ARCHIVE, READ, PDF

• Following special review of the International Sanitary Regulations by the Committee on International Quarantine adopts the International Health Regulations (WHA22.46) annexed to report – PDF

1968

1968 – Second edition publication of the history of WHO a was when “a new phrase entered the text of the second volume, ‘smallpox eradication’.” – PDF

• “This occurred because, in 1958, the Eleventh World Health Assembly unanimously adopted a resolution initiating a worldwide programme for eradication of the disease”

1967

1967 – Official start year of the WHO Smallpox Eradication Program – which was declared eradicate in 1980 – REF

1966

1966 – The 19th World Health Assembly requested the Director-General of WHO to initiate action to carry out a world-wide smallpox eradication programme- REF

1961

1961 – WHO” At the 13th World Health Assembly (1960)- WHO publish their first immunization schedule – including smallpox vaccination, DTP, BCG, and TAB – REF

• Smallpox Eradication discussed “emphasizing the urgency of of achieving world-wide eradication” from p23 – PDF
• Establishment of National Public Health Cadres (WHA13.36)

1958

May 28, to June 13 1958 – Eleventh World Health Assembly (WHA) – Eradication of Smallpox Resolution (WHA11.54) was unanimously adopted – WHA official minutes READ, PDF, ARCHIVE, CREDIT

• It was deemed an opportune time “to raise the problem of the world-wide eradication of smallpox in the near future”
• Smallpox control has been raised since the 3rd WHA as noted “Having regard to the decisions and pertinent practical measures adopted by WHO for smallpox control and the intensification of antismallpox programmes, in particular resolutions WHA3.18, (Executive Board) EB11.R58, WHA6.18, EB12.R13, EB13.R3, WHA7.5, WHA8.38 and WHA9.49″
• “investigation of the means of ensuring the world -wide eradication of smallpox, taking into account the fact that smallpox persists in certain areas despite repeated vaccination campaigns

1958 (Published) – History: The First Ten Years of the World Health Organisation (1948-1957) – READ, SOURCE

• Part I – Evolution of International Public Health – CH 1,
  • “International public health had its origin, just over a century ago, in the International Sanitary Confernce which opened in Paris on 23 July, 1851.”
• Part II – Establishment of the World Health Organisation
• Part III – Ten Years of Work

1956

May 8-25, 1956 – Ninth World Health Assembly – PDF, SOURCE International Certificate of Vaccination

• Resolution WHA9.49 – Under International Quarantine “Additional Regulations of 23 May 1956 amending the International Sanitary Regulations with respect to the Form of the International Certificate of Vaccination or Revaccination against Smallpox”

• “The intensified struggle against malaria would be impossible were it not for the mobilizing of WHO’s resources side by side with the resources of UNICEF -the transport, the sprayers and the DDT” [pg57] DDT is mentioned 43 times in the document.
• “Perhaps no two organizations in the United Nations are associated by the very nature of their activities as closely as WHO and UNICEF. You [WHO] give assistance in the form of technical knowledge and advice ; we [UNICEF] give it in the form of supplies, equipment and training”

1955

May 10-27, 1955 – Eighth World Health Assembly – PDF, SOURCE

• Resolution WHA8.38 Campaigns against Smallpox
  • “URGES again that health administrations conduct, wherever necessary, campaigns against smallpox as an integral part of their public -health programmes”
• May 26, 1955 – WHA8.30 on Malaria Eradication [think polio incidence]
  • The “ultimate goal of malaria -control programmes should be the eradication of the disease”
  • It is recognised that mosquito species Anopheles sacharovi are resistant to DDT in Greece and in Panama, Anopheles albimanus exhibited strange behaviour “after some six years of exposure to DDT, began in one area to avoid treated surfaces…” Such behaviour characteristic, if widespread, would of course make DDT useless for malaria control.”

1954

May 4-21, 1954 – Seventh World Health Assembly – PDF, SOURCE

• Resolution WHA7.5 Campaigns against Smallpox
  • “Considering that Article 2(g) of the Constitution provides that a function of the Organization shall be “to stimulate and advance work to eradicate epidemic, endemic and other diseases“
  • …continue studies on the most effective methods of smallpox control” etc
• Also note: WHA7.50 – Relations with UNICEF – “…Recognizing that UNICEF, originally an emergency organization, has recently been put on an indefinite basis”

1953

May 5-22, 1953 – Sixth World Health Assembly – PDF, SOURCE, credit 11th WHA 1958

• Resolution WHA6.18 Study on Campaign against Smallpox following executive board resolution (EB11.R58)

1952

1952 – WHO: Global Yaws control programme a tropical bacterial disease – REF, SOURCE, Wikipedia –READ

• “One of the first diseases to claim WHO’s attention was yaws, a crippling and disfiguring disease that afflicted some 50 million people in 1950. The global Yaws control programme, fully operational between 1952-1964, used long-acting penicillin to treat yaws with one single injection” (to which they have no vaccine “yet”!)

1951

May 25, 1951 – Fourth World Health Assembly – WHO Member States adopted the International Sanitary Regulations (ISR) (resolution WHA4.76), following the WHO Regulations No. 1 of 1948 which would later evolve into the International Classification of Diseases (ICD) – READ, REF

• WHA4.75 adn 4.76 – Adoption of the International Sanitary Regulations (WHO Regulations No. 2) –
  • In 1969 the regulations were renamed the International Health Regulations (1969), and amended again in 1973, 1981, 2005.
• IHR were originally intended to help monitor and control six serious quarantinable infectious diseases: cholera, plague, yellow fever, smallpox, relapsing fever and typhus which were reported in the WHO Weekly Epidemiological Record (WER).  Today, only cholera, plague and yellow fever are notifiable diseases.” [4]

1950

May 8-27, 1950 – Third World Health Assembly – The first WHO WHA Resolution made for smallpox (WHA3.18) – PDF, SOURCE, credit 11th WHA 1958

• “REQUESTS the Expert Committee on Biological Standardization to consider the question of the establishment of a centre for the testing and standardization of smallpox vaccines, with particular reference to dried vaccine and RECOMMENDS that greater weight should be given to smallpox in the regular programme for 1952” – Pg469
• References to DDT for controlling mosquitoes – vectors for malaria and yellow fever. Consider the statements
  • “DDT, penicillin and other drugs have greatly extended the possibility of preventive care and remedial measures being made available to the people.”
  • Yellow Fever: “DDT and other larvicides and insecticides-an inexpensive and effective way of destroying not only the Aedes aegypti [mosquito] but other vectors of disease”
  • Re Typhus and other Rickettsioses: “WHO had sent technical experts, vaccine and DDT.”
  • Annex 6 – Availability of DDT insecticides for combatting malaria in Agricultural areas from July 14, 1949 – “Recommends that Member Governments facilitate as much as possible the freer flow into the countries where they are needed of insecticides…”
• This is important information when you consider the trend in DDT use and polio incidence around this time – DDT is a highly persistent pesticide, and clearly recommended by the WHO. DDT poisoning looks a lot like polio! – READ

• “Between 1936, when his Government’s Malaria Division had been founded, and 1945, when the use of DDT had begun, campaigns against malaria had been carried out according to the methods then generally accepted. At the end of 1945, DDT spraying had begun in Venezuela” – [pg244 1956]

1948

1948 – In 1948 the WHO took over the responsibility for the International Classification of Disease (ICD), which dates back to the 1850s and was first known as the International List of Causes of Death. – REF, SOURCE

1947

1947 – WHO – Expert Committee on Biological Standardization meets on an annual basis since 1947 and is responsible for the establishment of the WHO International Biological Reference Preparations and for the adoption of the WHO Recommendations and Guidelines. – vaccines are “biologicals” – 2005 ARCHIVE

• Technical report series 2^nd (1949) to 54^th (2003) report – REPORTS
• 2002 Thiomersal in vaccines – WHO consider the the real benefits of these vaccines vastly outweigh the theoretical risk of thiomersal – so jab away until we get a replacement –READ
• 1994 DNA began discussion – READ

1946

1946 – Documentary: DDT Versus Malaria: A Successful Experiment in Malaria Control (released 1947), by the Kenya Medical Department – EXCERPT

June 8, 1946 – JAMA Vol 131 – Accidental ingestion of DDT, with a note on its metabolism in man- by M. I. Smith MD – pg 519 – READ

• First authentic report of the toxicity of DDT on man – CREDIT
• JAMA record notes urine analysis of man – where a 5% solution of DDT insecticide spilled onto chewing tobacco in man’s pocket ….he vomited… “became nauseated and apprehensive and experienced a sensation of tightness, [transient] stiffness and pain of the jaws and soreness of the throat.” – CREDIT
• [why am I documenting these data points? – because DDT’s “transient stiffness” aka paralysis <48hrs was diagnosed as “polio” up until 1955 (after release of Salk vaccine), before they altered the diagnostic definition of Polio]

1946 – DDT Killer of Killers – “In the summer of 1946, a poliomyelitis epidemic swept the country — the worst epidemic since 1916” – REF

• “In 1945, almost 33 million pounds of DDT were produced in the United States…Production was stepped up even higher in 1946…” – REF

July 22, 1946 – The Constitution of the World Health Organization (WHO)was signed in New York on July 22, 1946 on behalf of sixty-one States”, and came into force 2 years later on April 7, 1948 – TIMELINE

• The United Nations began operation October 24, 1945, under which the WHO was formed – TIMELINE

1945

1945 – Inactivated influenza vaccines introduced 1940s. “Since that time, they have been improved in terms of their standardization and purity.” – REF

• February 17, 1945: American Journal of Hygiene by Johns Hopkins University : The development of the 1943 vaccination study of the Commission on Influenza. Francis T Jr., 1945, 42:1-11 – READ
  • “Numerous investigations since 1935 have demonstrated that influenza virus in a variety of mateirals is capable of inducing a rise in circulating antibodies after subcutaneous inoculation of human individuals. The essential question of whether effective prophylaxis against influenza was obtainable…had …not been answered.”
• “These investigations were aided in part by the Commission on Influenza, Board for the Investigation and Control of Influenza and Other Epidemic Diseases in the Army, Preventive Medicine Service, Office of The Surgeon General, US Army, Washington DC.” Under Major General Norman T. Kirk, who established “the opportunity to study the effect of vaccination against influenza”
  • [The US Army was instrumental in bringing about the first influenza vaccine]
• Biological firms “who participated experimentally in the production of the vaccine used and furnished it at minimal cost” includes Lederle Laboratories, Parke, Davis and Company, and Sharp and Dohme

1945 – DDT use began (important in reference to polio) – [pg244 WHA 1956]

April 21, 1945 – British Medical Journal – first case study reported of DDT poisoning via skin – developing paralysis like symptoms – READ, CREDIT

1945

1945 (onward) – Archived documents from Dr. Szeming Sze who was instrumental in the creation of the World Health Organization (WHO) through the United Nations delegation (many PDFs) – ARCHIVE, WHO constitution – TIMELINE

1934

1934 – DDT is rediscovered “in the scientific laboratories of JLR. Geigy, A. G., of Basle, Switzerland”, name dichloro-diphenyl-trichloroethan (DDT)

• [ BOOK: DDT: Killer of Killers by O.T. Zimmerman – READ]

• Then in 1939 the Colorado potato beetle came to Switzerland and an experiment with “a 1 % DDT dust” was successfully used. It was then used on heads to kill lice- REF
• In 1943, DDT was in commercial production at the Cincinnati Chemical Works, a subsidiary of Geigy Company, Inc., and early in 1944, Du Pont, Merck, and Hercules Powder Co. also went into production.”

1926

1926 – Australia hosted the League of Nations’ first international conference on health – REF

• The delegates discussed early warning systems for epidemics and quarantine issues, as well as various medical problems… then the Great Depression hit followed by World War II, afterwhich the World Health Organisation is formed in 1946

The post World Health Organisation (WHO) “vaccine” agenda first appeared on Totality of Evidence.

In that statement which was quoted widely by the media [4, 5, 6, 7], CDC Director Dr. Rochelle Walensky stated:

“CDC encourages all pregnant people or people who are thinking about becoming pregnant and those breastfeeding to get vaccinated to protect themselves from COVID-19,”

A preprint study released Aug 9, 2021, of a “new CDC analysis of current data from the v-safe pregnancy registry assessed vaccination early in pregnancy and did not find an increased risk of miscarriage among nearly 2,500 pregnant women who received an mRNA COVID-19 vaccine before 20 weeks of pregnancy.”  The study, as of Jan 2024, has still NOT been peer reviewed!  Yet Obstetricians and Gynecologists organisations used it and previous v-safe “analysis” to also promote vaccinating pregnant women.

The post CDC: All pregnant and breastfeeding “people” get COVID-19 vaccine first appeared on Totality of Evidence.

Initially, on Jan 28, 2021, the CDC planned to call anyone who reported an adverse health impact to v-safe (v-safe protocol v.2 at p.5) but by May 20, 2021 they “had to abandon that plan early on after rolling out v-safe due to the volume of people reporting impacts (v-safe protocol v.3 at pp.7-8)” [6]  They also didn’t include their proposed Adverse Events of Special Interest (AESI) as check boxes.

On December 29, 2020 the CDC decided to set up the V-Safe Pregnancy surveillance protocol which would look for pregnant women and ask them to join the v-safe pregnancy registry. It was based on data from this registry that the CDC first recommended the CV19 jabs to “pregnant persons” on April 23, 2021. [2, 3]

As this is public information, and the CDC promised transparency, ICAN through it’s lawyer Aaron Siri, FOIA’d the CDC for all the v-safe data.  Following 464 Days of trying and ultimate having to sue the CDC in court, the check box info [7] from over 10 million users was released under court order on September 30, 2022 and then not until February 15, 2024 also under court order , the 7.8 million “free text” field data will be released. [4]

• ICAN V-Safe FOIA data – HERE

V-safe has now been expanded to include other vaccines.

The post CDC launches V-Safe App to track COVID-19 vaccine side effects first appeared on Totality of Evidence.

Three days earlier, April 21, 2021, CDC scientists published [original] preliminary findings from data collected from the “v-safe after vaccination health checker” surveillance system, the v-safe pregnancy registry, and the Vaccine Adverse Event Reporting System (VAERS) in order “to characterize the initial safety of mRNA COVDI-19 vaccines in pregnant persons”.

Between December 14, 2020, to February 28, 2021, (the first 11 weeks of the U.S.’s vaccination effort) a total of 35,691 v-safe participants 16 to 54 years of age identified as pregnant, of which only 3,958 participants (11%) enrolled in the v-safe pregnancy registry. Of the 827 that had a completed pregnancy “115 (13.9%) were pregnancy losses and 712 (86.1%) were live births (mostly among participants vaccinated in the third trimester)”.  “Preliminary findings did not show obvious safety signals among pregnant persons who received mRNA Covid-19 vaccines.” [2]

Adverse neonatal outcomes included preterm birth (in 9.4%) and small size for gestational age (in 3.2%); no neonatal deaths were reported.

Examination of the original CDC paper challenged the findings and revealed an 81.9% chance of miscarriage following COVID-19 mRNA vaccination in the first two trimesters when definitions were applied correctly to the data in the paper. 104 spontaneous abortions out of a total of 127 vaccinated under 20 weeks gestation equates to 81.9%.  The authors adjusted their paper to correct for their “mistake”, and eliminated this alarming finding. [3, 4]

The post CDC recommends COVID-19 vaccine for “pregnant people” first appeared on Totality of Evidence.

I first heard Dr Park’s speak in her August 2021 Michigan testimony where in a very short space of time she laid out the massive vaccine falsehoods!

Dr Park’s Official Sites:

• Telegram – HERE
• Rumble Channel – HERE
• Vaccine Injury Treatment Alliance (VITA) – WEB, WATCH

Link in reverse chronological order

2023

December 2, 2023 – Rise + Resist | 2nd Annual CHD Conference: The Vaccine Schedule: The Good, The Bad + The Ugly – panel with Dr Christina Parks, Dr Brian Hooker, Dr James Lyons-Weiner, Dr Paul Thomas & DeeDee Hoover – WATCH

• Autism is a “catch-all” for many types of neurodegenerative disorders. Inflammation is a key marker for the development of autism. So anything during pregnancy or during the first two years of life that causes inflammation can potentially lead to abnormal neurodevelopment – Synaptogenesis

November 29, 2023 – Gender Dysphoria & ASD: A Scientific Discussion – what is causing the increased incidence of gender dysphoria in person’s within the autism spectrum community – WATCH

October 13, 2023 – Dr. Parks on Glutathione-The Most Important Molecule You’ve Probably Never Heard Of – WATCH

September 29, 2023 – Vaccine Injury Treatment Alliance Overview – WATCH

September 20, 2023 – AFLD | Issue Brief: Poisonous Effects of Roundup Weedkiller – READ

• “glyphosate destruction of the gut is a key contributor to making people susceptible to vax damage ” Dr Parks

September 19, 2023 – What Don’t They Want You To Know About Vitamin C? (intro) – WATCH

September 14, 2023 – Boyce Watkins: This woman’s pandemic testimony rocked the world – Dr Christina Parks of BlackHealthSecrets.com – WATCH

September 5, 2023 – Shots Fired: SPARTACUS Actor’s Life Ruined from Vax Side Effects! – WATCH, Dr Parks details the serious issues with this genetic vaccine technology – EXCERPT

Auguast 18, 2023 – Maria Zeee | Uncensored: Dr. Christina Parks – mRNA Can Be Programmed to Make Humans Unable to Eat Meat – WATCH

August 10, 2023 – Emerals Robinson: UNDERSTANDING THE HUMAN CONTROLLING TECHNOLOGY BEHIND COVID JABS – WATCH

August 3, 2023 – VSRF Livestream #88: ‘Young Athletes Are Falling’ with Christina Parks, PhD & Robert Seik, PharmD – WATCH

July 27, 2023 – The White Coat Summit | The Reckoning – Read the Science Dr Christina Parks – WATCH, WATCH

July 2023 – The United Heathcare Summit: Polio vaccine contaminated with monkey virus SV40 – growing vaccines on animal tissue – EXCERPT

June 20, 2023 – Healing From Covid Related Illnesses – WATCH

May 12, 2023 : America’s Frontline Industrial Hygienists & Multidisciplinary Support Summit | Burlington, Vermon, Mask Survey: 3. Respiratory Hazards of Masks: Keynote by Dr. Christina Parks – the harms of mask wearing – WATCH

~May 2023 – OAN | In Focus: fauci masks work at teh margins maybe 10% – WATCH

March 27, 2023 – Vets & Visionaries with Kristen Meghan: Reforming informed consent, amending pharma trial ethics, and increasing autism awareness with Dr. Christina Parks| Ep. 10 – WATCH, BACKUP, READ

January 24, 2023 – Senator Ron Johnson COVID-19: A Second Opinion – FULL, Dr. Christina Parks Full Highlights – WATCH

2022

December 2022 – Diamond & Silk: PHD Molecular Biologist Christina Parks joins Diamond and Silk to discuss IT ALL – WATCH, featuring Dr Christina Parks regarding “shedding” – EXCERPT

November 26, 2022 – Vaccine Safety Research Foundation (VSRF) Thanksgiving Marathon- Reel 3: Dr. Christina Parks, Dr. Richard Urso, Angela Wulbrecht, & Lisa Laehy – WATCH

August 26, 2022 – Epoch TV: Gateway to Freedom Conference: Real Medicine – (@2:16:40) Dr Christina Parks – WATCH

January 12, 2022 – Dark to Light Podcast: Dr. Christina Parks – READ & LISTEN (very informative)

2021

August 19, 2021 – Michigan House Bill 4471 (HB4471) which seeks to ban discrimination based on vaccine status – Dr. Christina Parks Testimony – WATCH, BACKUP, Scientific resources supporting testimony – PDF

What I want to address today, in this limited time, is the fact that vaccine requirements and mandates are based on the faulty assumption that the vaccines in question prevent transmission of the pathogen….In fact they were never designed to do that.

Dr Christina Parks

• Vaccination predisposes those exposed to Antibody Dependent Enhancement (ADE), which results in more severe disease; show specifically for the Delta variant
• Data indicates COVID-19 Fully vaccinated people can carry as much Delta variant as unvaccinated people
• Fully vaccinated persons made up 74% of people testing positive for COVID-19 in the Barnstable Massachusetts outbreak and 4 out of 5 (80%) of those were hospitalized
• COVID-19 vaccine does not prevent transmission, just like the DTaP and Flu vaccines do not

The post Dr Christina Parks first appeared on Totality of Evidence.

Links in reverse chronological order

2024

November 16, 2024 – X: Tulsi Gabbard (Trumps appointed Director of National Intelligence) explains shutting down 25-30 US biolabs in Ukraine – WATCH

September 27, 2024 – LifeSite News: Rep. Paul Gosar introduces bill to end vaccine manufacturer immunity from injury lawsuits – READ

• Press Release: Gosar Introduces Legislation to Sue Big Pharma for Vaccine Injuries – READ, ARCHIVE
• H.R.9828 – To amend the Public Health Service Act to end the liability shield for vaccine manufacturers, and for other purposes. – READ “The End the Vaccine Carveout Act would allow individuals to “bring a civil action against a vaccine administrator or manufacturer in a State or Federal court for damages arising from such injury or death,”

September 25, 2027 – Gateway Pundit: Report: Ex-New York Governor Andrew Cuomo Accused of ‘Inappropriately Influencing’ Former Staffer as House Probes COVID Deaths – READ

• NY Post: Ex-Gov. Cuomo ‘inappropriately influenced’ witness in text message as House probed COVID deaths: memo – READ

September 6, 2024 – Dr Makis X: BREAKING NEWS: COVID-19 Vaccine Clinics across Canada have been ordered to destroy all vials of Pfizer & Moderna COVID-19 mRNA Vaccines! – TWEET

• “The Public Health Agency of Canada (PHAC) has issues a market withdrawal of all COVID-19 XBB vaccines in Canada, to take place on September 1, 2024” to help KP.2 formulations rollout – LETTER
• “As part of the authorization of the new formulation for the fall, Health Canada will remove the strain identifier (XBB ? KP.2 etc.) from the naming convention of the COVID-19 vaccine products to anable the assignment of done drug identification number (DIN) for each presentation on an ongoing basis”

September 4, 2024 – Gateway Pundit: EXCLUSIVE: Whistleblower and Combat Veteran ‘Unmasks the VA’s Unethical Experimentation’ – READ, Unmasking the VA’s Unethical Experimentation – READ

• Sonny Fleeman is a federal whistleblower, member of Feds for Freedom, and Declaration of Military Accountability signatory.
• Alleges Motivational Interviewing (MI) , A Counseling Tool Turned into a Weapon of psychological manipulation to convince vetrans to submit to COVID-19 injections

September 1, 2024 – Limitless Expo via Gateway Pundit: RFK Jr. Calls for ‘Reckoning’ for ‘Immoral, Homicidal, Criminal Behavior’ During COVID-19 Pandemic – READ , WATCH, Limitless Expo – HERE

• “a powerful speech that reignited the debate over the handling of the COVID-19 pandemic”

August 23, 2024 Robert F. Kennedy Jr. Address to the Nation – WATCH, Gateway Pundit – READ, TIMELINE

• On Friday August 23, 2024 Robert F. Kennedy Jr. Address to the Nation, officially suspending his presidential run in 10 key swing states and endorsing President Donald J. Trump – He is pushing to Make America Healthy Again, end the Ukraine war and stop censorship.
• “During the exclusive interview with Dr. Phil, Kennedy revealed that internal polling data showed 57% of his supporters would back Trump over Kamala Harris if he exited the race.” – READ
• Soon after other “Democrats” endorsed Trump – Tulsi Gabbard – WATCH, Dr Robert Malone – WATCH, Bret Weinstein – READ

August 22, 2024 – FDA Press: FDA Approves and Authorizes Updated mRNA COVID-19 Vaccines to Better Protect Against Currently Circulating Variants – READ (note some indications are still under EUA!)

• (2024-2025 formula) to include a monovalent (single) component that corresponds to the Omicron variant KP.2 strain of SARS-CoV-2.
• NY Times: New covid shots were approved. But who will get them? Many older Americans, including those in nursing homes, aren’t getting booster shots. – READ

August 19, 2024 – We The Patriots USA: President Trump Holds Private Meeting to Discuss Medical Freedom, Vaccines – Dawn Jolly, We The Patriots USA President sits down with President Trump – READ, CREDIT

“I Hear You, I Heard You, and Tell Your People I Hear Them”

– President Trump

• “The organization is also circulating a petition to amend federal law to make it illegal for anyone to be discriminated against based on their vaccination status.”

July 8, 2024 – Heritage Foundation | REPORT: Holding China Accountable for Its Role in the Most Catastrophic Pandemic of Our Time: COVID-19 – READ

July 6, 2024 – 42nd Annual Meeting of Doctors for Disaster Preparedness: How COVID-19 Public Health Policies Neglected “the Disease, the Patient, and the Physician.” presentation by Dr Ronan Connolly – WATCH

July 6, 2024 – NEJM: Funding Postauthorization Vaccine-Safety Science – by Salmon, Orenstein, Stanley Plotkin, and Robert T. Chen – READ, Conflict of Interest disclosures – PDF [They want more money to do vaccine “safety” studies, the very thing they have been telling the public for decades has been done – the science is settled!!!!!]

• Aaron Siri Substack: AND LIKE THAT, THE CLAIM VACCINES ARE THE WORLD’S BEST STUDIED PRODUCT DIES – The world’s leading vaccinologist, Dr. Stanley Plotkin, and company have just capitulated… – READ
• The Highwire Ep 380: Impact of Aaron Siri’s congressional testimony [1, 2] waking up lawmakers, and discussing ICAN’s win with this paper – EXCERPT
• July 9, 2024 – Johns Hopkins | Institute for Vaccine Safety: Establishing Ongoing Funding for Post-Authorization Vaccine Safety Science – READ (see ref 2.4, and Salmon sponsored by JH). Point 14: What science is needed?
  • The Institute for Vaccine Safety (IVS) was established October 1, 1997 [ARCHIVE, time of MMR controversy – ARCHIVE] at the Johns Hopkins University School of Public Health it’s director is Dr. Daniel Salmon, the lead author of NEJM paper – [only now want more vaccine safety funding!]
  • Robert T Chen Scientific Director, of Brighton Collaboration, A program of the Task Force for Global Health, Decatur, GA, USA, [He was one of first (1994) to write about VAERS database when with CDC – READ]

July 1, 2024 – SCOTUS blog: Justices rule Trump has some immunity from prosecution – 6-3 – READ, Gateway Pundit – READ, TRUMP v. UNITED STATES decision – READ, NY Post – READ

• Supreme Court Rules 6-3 on Presidential Immunity – “Court holds that a former president has absolute immunity for his core constitutional powers”

July 1, 2024 – War Room’s chief Steve Bannon takes himself to Danbury, Connecticut jail for 4 months – Federal Inmate Number 05635-509 Stephen K. Bannon – WATCH, Special – WATCH, Political Prisoner Ep 3723 – WATCH, Ep 3724 – WATCH, Gateway Pundit – READ

• Context: The Interview that made him a marked man – WATCH
• June 28, 2023 Steve Bannon interview with Megyn Kelly – WATCH

June 30, 2024 – Gateway Pundit: RFK Jr. Leaves Dr. Phil Stunned As He Explains Huge Kickbacks Fauci and NIH Have Earned From Moderna Vaccines – READ, WATCH, X

June 30, 2024 (aired) – Australia’s 7NEWS Spotlight: After COVID: What did we do wrong? YouTube uploaded July 5, 2024 – WATCH, ARCHIVE (most of the comments are negative)

• Australia’s 7News Spotlight Special Event: AFTER COVID – READ, READ
• 7NEWS Spotlight: After COVID: What did we do wrong? uploaded July 5, 2024 – WATCH, ARCHIVE
• Club Grubbery: Gigi Foster speaks after the Channel 7 Spotlight – WATCH,
• Leaked (inconvenient) audio not included in the episode – TWEET, More from Prof Karen Phelps – TWEET
• Letters from Australia: Spotlight on Seven: What didn’t make the cut might save your life – READ

June 28, 2024 – Dr Malone Substack: Chevron Deference Overturned by SCOTUS – Major win for conservatives, major loss for administrative state power – READ Supreme Court decision LOPER BRIGHT ENTERPRISES ET AL. v. RAIMONDO, SECRETARY OF COMMERCE, ET AL– PDF (Re Chevron precedent), SCOTUS blog – READ, NY Times – READ

• “The Court granted certiorari in these cases limited to the questionwhether Chevron U. S. A. Inc. v. Natural Resources Defense Council, Inc., 467 U. S. 837, should be overruled or clarified….”
• “Chevron deference is an administrative law principle that compels federal courts to defer to a federal agency’s interpretation of an ambiguous or unclear statute that Congress delegated to the agency to administer. As a consequence, executive branch administrative [Federal] agencies have been able to step into the policy and power vacuums created when the legislative branch fails to define legislative intent clearly, and to functionally define law and policy as each agency sees fit.” – REF – [now Congress needs to make the law clear!]
• Bannons War Room Episode 3721 “The Administrative State Is Dead” – WATCH, FULL
• This will affect Brook Jackson’s Pfizer case – READ

June 28, 2024 – US Supreme Court hands down decision Fisher v Untied States – PDF (2002 law passed from Enron scandal set precedent we “obstructing an official proceeding”.) CNN – READ,

• Julie Kelly includes unbelievable backstory of how the DOJ abused this statute and used it to imprison J6ers on “pre-trial detention”, many for years, before even being allowed to stand trial! – WATCH, READ,

• Justices rule for Jan. 6 defendant: “By a vote of 6-3, the justices ruled that the law that Joseph Fischer was charged with violating, which bars obstruction of an official proceeding, applies only to evidence tampering, such as destruction of records or documents, in official proceedings.”- READ
• The ruling could affect charges against more than 300 other Jan. 6 defendants, already imprisioned. – REF
• “Supreme Court administers some sanity to an insane Justice Department” – Dr Simone Gold‘s bodyguard has been imprisoned under this DOJ’s interpretation of the law – Dr Malone – READ, AFLD – READ
• “Today’s decision means Attorney General Merrick Garland and federal judges in Washington wrongfully prosecuted roughly 350 J6ers with the post-Enron felony,”…the” U.S. Supreme Court today overturned how the DOJ has used 18 USC 1512(c)(2), the most prevalent felony in J6 cases”. – Julie Kelly – READ

June 27, 2024 – Debate between Trump v Biden DEBATE makes plain and clear Who is (has been) running America? – WATCH

• Sky News Australia: MSNBC changes its tune on Joe Biden following ‘trainwreck’ presidential debate- WATCH, NY Post – READ,
• Joe is helped off the stage by Dr Jill Biden – WATCH, READ
• In the week leading up to the debate Biden was at Camp David preparing – READ, yet media claim his failed debate is due to his taxing schedule – READ, and other excuses – READ
• Joe Biden is “sharp as a tack” – mockingbird media montage – WATCH
• This debate is earlier than usual with an unprecedented format ile lack of a studio audience – will be a departure from previous debates – READ, READ

June 26, 2024 – Robert F. Kennedy Jr. on X: “Five States – Texas, Utah, Kansas, Mississippi and Louisianna – suing Pfizer for knowing and concealing the vaccine causing myocarditis, pericardisits, failed pregnancies and deaths. That’s 10% of US States. The tide is turning” – TWEET, Zeee Media w/ Karen Kingston explains – WATCH, Hindustan Times- READ

• Idaho soon to file lawsuit against Pfizer – EXCERPT
• Why Pfizer and not Moderna? Pfizer didn’t participate in the Operation Warp Speed program – EXCERPT
• June 17, 2024 – Kansas AG sues Pfizer – ARCHIVE
• November 30, 2023 – TEXAS AG sues Pfizer – READ
• Unable to find claim for Utah – HERE, Mississippi – HERE, Louisianna (AG website glitch) – HERE

June 26, 2024 – House Judiciary Subcommittee on the Administrative State, Regulatory Reform, and Antitrust : Follow the Science?: Oversight of the Biden Covid-19 Administrative State Response – READ, WATCH, BACKUP

• How commitee “found how the Biden Administration pressured the Food and Drug Administration (FDA) to “cut corners” and lower agency standards to approve the Pfizer COVID-19 vaccine and authorize boosters.” – REPORT
• Led by Rep Massie – opening statement – WATCH, Mr Correa opening statement “Let me start by saying vaccines are a true miracle” – WATCH
• Witnesses: Dr. Philip Krause, former FDA Office of Vaccines Research & Review, Aaron Siri, Vaccine litigation expert and Jordan Vaughn, MD of Microvascular Research Foundation

June 24, 2024 – US House Judiciary Subcommittee on the Administrative State, Regulatory Reform, and Antitrust, led by Chairman Thomas Massie: NEW REPORT: Biden Administration Pressured FDA and Ignored Risks During Initial COVID Vaccine Phase – READ, Dr Nass – CREDIT

• Interim staff report titled, “Politics, Private Interests, and the Biden Administration’s Deviation from Agency Regulations in the COVID-19 Pandemic” – PDF
• “The report details how the Biden Administration pressured the Food and Drug Administration (FDA) to go beyond its regulatory authority to change its procedures, cut corners, and lower agency standards to approve the Pfizer COVID-19 vaccine and authorize boosters.”
• The FDA bait-and-switch licensing and supply fraud, was exposed back in August 2021 by Dr Meryl Nass and Dr Robert Malone – READ, READ, TIMELINE, FDA BLA approval letter to Pfizer August 23, 2021 – PDF

June 17, 2024 – Attorney General Kris Kobach: Kansas AG sues Pfizer for misleading Kansans on COVID vaccine – ARCHIVE, Reuters – READ, Kansas lawsuit – PDF, Peter Sweden Substack – CREDIT, Kansas Reflector – READ

• Pfizer lied safety to pregnant women, side effects such as myocarditis and lied about the effectiveness of the injection as well and that it does not stop transmission
• filed a civil lawsuit – alleging that “Pfizer misled the public that it had a ‘safe and effective’ COVID-19 vaccine,” violating the state’s Consumer Protection Act – REF

June 12, 2024 – Gateway Pundit: Candace Owens Clashes With Piers Morgan — Shuts Down His COVID-19 Shots Talking Points: ‘People Died!’ – “dismantling his previous pro-vaccine stances and slamming the government’s unconstitutional mandates during the COVID-19 pandemic.” – WATCH, READ

• What about the other types of shots Piers asks Candace – “I don’t vax my children, we travel the world, my children are never sick. I am proudly as you media terms it “anti-vax”…Big Pharma is not God...”- EXCERPT

June 9, 2024 – Gateway Pundit: Law Professor Dr. Francis Boyle, Who Drafted the 1989 Biological Weapons and Antiterrorism Act, Claims COVID-19 mRNA Injections are Weapons of Mass Destruction in New Affidavit under penalty of perjury – READ

• “Dr. Boyle’s affidavit, which was submitted as part of an emergency petition for a writ of mandamus in Florida, argues that the distribution of COVID-19 vaccines violates several statutes, including the U.S. Code on Biological Weapons and Florida’s statutes on weapons and firearms.” Dr. Joseph Sansone reports – READ

June 7, 2024 – Bannons War Room Episode 3669: The WHO Pushes The Next Pandemic – “bird flu” – WATCH Noor Bin Ladin reports – EXCERPT

June 7, 2024 – Health Freedom Defense Fund (HFDF): HUGE Legal Victory – HFDF Wins Appeal in Ninth Circuit on Los Angeles Unified School District’s Employee COVID-19 Vaccination Mandate – READ, LouDobbs – READ

• They are NOT “vaccines”, but are medical treatments, curbing “disease” i.e. symptoms in the individual, they don’t have a community benefite of “preventing the spread” of the “disease” i.e. the pathogen.
• Reference to the Supreme Court’s 1905 decision in Jacobson v. Massachusetts case where it held that vaccination prevented the spread of smallpox.

May 23, 2024 – Where are the Numbers?: We were right! The UK ONS now admit that deaths in the vaccinated were categorised as unvaccinated in 2021– The ONS denied it then but admit it now. – Fenton et al – READ

• In 2021 the ONS data had “large spikes in the non-covid death rates in the ‘unvaccinated’…coincided with the first main vaccine rollout and did so for each age group” – READ
• Definition of vaccinated: “We asserted that these obvious anomalies were a result of the standard ONS procedure of categorising anyone within 20 days of their first dose as ‘unvaccinated’. However, in our own discussions with the ONS they maintained that, although that method was used for their efficacy calculations, it was not used when it came to mortality.”
• “To ‘explain’ the spikes the ONS pushed the implicit assumption that there was a phenomenon called the ‘healthy vaccinee’ effect, whereby they claimed that people ‘close to death’ were not vaccinated… without any data to support it whatsoever.” “…it could not possibly have explained those spikes in mortality rates. They could only be explained by categorising deaths shortly after vaccination as unvaccinated.”
• As a result of a subject access request that Clare Craig submitted to the ONS we have now found out that we were correct after all! – THREAD
• “Why is this so important? Because the ONS data – possibly more so than any other source of data in the world – was used to bolster the claim that the vaccines were highly effective and safe.“…The ONS “therefore lied and intentionally created and spread misinformation.”

May 19, 2024 – Arkmedic Substack: How many coincidences…before it becomes mathematically impossible? – READ

From the Codon Wheel you can see that multiple triplicates of nucleotides can code for the same amino acid. Chains of amino acids form proteins. Proteins are made from mRNA.

For example the amino acid Alanine can be coded for by GCU, GCC, GCA or GCG – 4 different combinations”

All of the COVID-19 vaccine spike protein sequences are only about 70% similar to the original Wuhan viral strain, meaning the manufactures have computer generated the codon sequences to have the same amino acids sequence, but the underlying viral code sequences are ALL 30% different to the original.

They are saturated with CGG, which is not “optimal” but it does happen to accommodate CRISPR functionality? What a striking coincidence!

May 18, 2024 – Epoch times: Health Canada has refused on several occasions to confirm whether it made a request to Pfizer for the removal of the Simian Virus 40 (SV40) DNA regulatory sequence in its COVID-19 vaccines. – READ

May 16, 2024 – Australians for Science & Freedom: FAKE NEWS: Study does NOT show covid gene-vaccines “saved nearly 20,000 lives in NSW alone” – wild claims from Moderna-linked-university study – READ

• Re definition of “vaccinated” or “no effective dose”, and many other “Catastrophic confounds in study promoting mRNA”

May 16, 2024 – VRBPAC 185th meeting: “the [FDA Vaccines Advisory] Committee will meet in open session to discuss and make recommendations on the selection of strain(s) to be included in the 2024-2025 Formula for COVID-19 vaccines.” – WATCH, READ, ARCHIVE, Aaron Siri – CREDIT

May 14, 2024 – Paul Weston on Covid Britain’s Dr Mengeles’ – review of Doctors et al on TV promoting CV19 vaccines yet getting paid by Pharma (Pfizer, AstraZeneca etc), Ofcom’s and politician CONFLICT OF INTEREST – WATCH, BOOK

There are so many lies, and so many crimes around this, and if we lived in a true democracy our courts would be crammed and our prisons over flowing with doctors, politicians, scientists and journalists by now, and the fact that they aren’t is testament to the sheer, terrifying scale of globalist power.

Paul Weston

The Great Covid Con: Introduction – WATCH
Fraudulent Death Rate Data – PART 2 – WATCH
Care Home Horrors – PART 3 – WATCH
Murder, Midazolam & Matt Hancock – PART 4 – WATCH

May 12, 2024 – The Forgotten Side of Medicine AMWD: Dissecting the New York Time’s Plea for Vaccine Amnesty – Reviewing a remarkably disingenuous “apology” and what actually caused the vaccine disaster – READ, Dr Kory – READ, Prompted by recent NY Times article admitting Vaccine injury

• The attempt to restore the public’s trust in our medical institutions without any of them admitting fault with “the most compelling explanations” as to why!
• “Before the vaccines came out, we repeatedly heard messaging stating that if you felt awful, that meant “it was working.” This for context [MWD states] was not something I’d heard from any other vaccine.”
  • Feeling sick following vaccin-ation has actually been a thing since smallpox – making a healty “patient” sick in order to make them well – READ

May 9, 2024 – The Highwire Ep 371 – The Fall of “Safe & Effective” – WATCH

• New York Times (et al) finally admit there are COVID-19 vaccine injuries
• Chris Cuomo (who pushed the vaccine hard) now admits to being vaccine injured and is taking ivermectin (which he says he didn’t know was a legitimate human approved drug, not a horse-dewormer) – all which was deemed “misinformation”.

May 3, 2024 – NY Times: The Side Effects of Covid Vaccines – Thousands of Americans have filed vaccine-injury claims with the federal government By David Leonhardt – READ, ARCHIVE, CREDIT,

May 3, 2024 – NY Times: Thousands believe covid vaccines harmed them. Is anyone Listening? By Apoorva Mandavilli – READ, ARCHIVE, CREDIT

• Finally the New York Times officially admits to vaccine injury – [Limited Hangout]
• Reminder, the CDC expected mass vaccine injury back early December 2020 – WATCH

May 1, 2024 – Nature: Scientists tried to give people COVID– and failed, Researchers deliberately infect participants with SARS-CoV-2 in ‘challenge’ trials‘ — but high levels of immunity complicate efforts to test vaccines and treatments – READ !!!

April 29, 2024 – ICAN: Disturbing FDA Loophole Allows Scientists To Do Experiments On Humans Without Informed Consent – READ ICAN filed FOIA request – major implications with regards to proposed “inhaled vaccines”

• An FDA rule change published on December 21, 2023 solidifies that scientists are allowed to conduct human experiments without informed consent, as long as the research poses “minimal risk” and includes “appropriate safeguards to protect the rights, safety, and welfare of human subjects.”
• Investigation by ICAN’s legal team revealed that efforts to undermine informed consent protections have long been in the works, going back to at least 1962.“

April 28, 2024 – Dr Joseph Sansone Substack: BREAKING: Arizona Republican Party Declares Covid-19 Injections Biological and Technological Weapons, Passed “Ban the Jab” Resolution! -Passed with 95.62% of the vote!- READ Dan Schultz of the Precinct Strategy, submitted the resolution to Maricopa County, the largest Republican County in the nation – READ, Gateway Pundit – READ

• “The resolution declares the COVID-19 injections biological and technological weapons and calls on the Governor to prohibit their distribution, the Attorney General to confiscate the vials and conduct a forensic analysis of their contents.

April 22, 2024 – Gateway Pundit: Lawsuit Seeks to ‘Ban the Jab’ in Florida — Declares Injections Biological and Technological Weapons – READ

• On March 3^rd, 2024, Dr. Joseph Sansone filed a Writ of Mandamus in the Supreme Court of Florida seeking to compel Governor Ron DeSantis to prohibit the distribution of Covid 19 injections (nanoparticle injections/mRNA injections) in the State of Florida.

April 18, 2024 – Eureka Alert: Following longest known chronic SARS-CoV-2 infection of 613 days, experts highlight the risk of development of novel potentially immune-evasive SARS-CoV-2 variants due to persistent infections in immunocompromised patients – READ

• Becoming incubators for new variants due to increasing number of mutations in the virus genome.
• Research prepared for European Society for Clinical Microbiology and Infectious Diseases (ESCMID) Global Congress in Barcelona on April 27-30, 2024.
• Daily Star: Record Holder: 72-Year-Old Dutch man Dies After Battling Covid for 613 Days, Virus Mutated Over 50 Times, creating a “highly mutated novel variant”, he was vaccinated and boosted prior to catching Omicron Feb 2022 – READ, People – READ, SCMP- READ, Time – READ

April 13, 2024 – Pharma Files: Massive Rallies Break Out Across Japan Against WHO’s Pandemic Treaty – WATCH & READ, BACKUP

• Just after Japanese Professor, Masayasu Inoue, Delivers Stunning Message for the World – WATCH, BACKUP

April 11, 2024 – Cell: Self-amplifying RNA COVID-19 vaccine – Wayne and Blakney – READ

• In November 2023, Japan’s Ministry of Health, Labour and Welfare granted regulatory approval of ARCT-154, a self-amplifying RNA COVID-19 vaccine developed by Arcturus Therapeutics.
• Clinical trials used mRNA vaccine BNT162b2 as the control – no placebo!

April 10, 2024 – The Nightly: COVID-19 inquiry: Federal police union wants ‘national guard’ [made up of citizens] to ease burden on officers in next pandemic – READ, The West – READ, CREDIT, [Questions: didn’t we just have the 100 year pandemic?]

• Australian Federal Police Association has called for a feasibility study into the concept in its submission to the Commonwealth’s inquiry into COVID-19.

April 3, 2024 – Pharma Files Substack: Germany’s Developing Scandal! Germany #RKIFiles – WATCH & READ

• Julian Gillespe: Zee Germans did not follow Zee Science…. so what makes you think Australia did? – READ

April 2, 2024 – Stefan Homburg: What do the RKI-Files really show? – WATCH

April 1, 2024 – Robert Malone Substack: German Corona Policy Political Crisis – FOIA of Robert Koch Institute Documents Reveals Political Manipulations – READ, ARCHIVE, FOIA Documents (German) – HERE, Reiner Fuellmich “Their house of cards is collapsing” – WATCH, Pharma Files – READ

• As refrenced by Reiner: “German alternative media magazine “Multipolar” are shaking up German politics on the eve of the critical 2024 European Parliament election in Germany which is scheduled to be held on 9 June 2024″
• “The documents reveal COVIDcrisis policy interactions and deference by Robert Koch Institute (RKI) public health scientists to unnamed politicians.”…Despite extensive redactions (ergo censorship) in the currently released documents, one key fact which has been revealed is that politician(s) overrode RKI scientists and physicians to enact mandated but counterproductive COVID public health policies.”
• “The identity of these politicians were redacted, but they may reside within the German government, or may be from the superior European Union…”
• Paul Schreyer articles in Multipolar: FOI Robert Koch Institute (RKI) Corona Protocol – German – READ1, READ2, READ3
  • RKI Germany “…the tightening of the risk assessment from “moderate” to “high” announced in March 2020 – the basis of all lockdown measures and court rulings on them – was not based, contrary to what was previously claimed, on a professional assessment by the RKI, but on the political instruction of an external actor – whose name is blacked out in the protocols.”

March 31, 2024 – FLCCC Substack: “Coloring Outside the Lines” – Thankfully Four Years AGO, the FLCCC Sparked a Healthcare Revolution – Beginning on Day One – READ

March 30, 2024 – Arkmedics Substack by Dr Ah Kahn Syed: The New Eugenics Movement – Part 2 – READ

• A List of the “safe and effective” claims that are rapidly being retracted:

• It’s just a vaccine
• It stays in the arm
• It only lasts a few days
• It doesn’t integrate into the genome
• It’s not gene therapy
• There is no DNA in the vaccine
• It doesn’t go to the nucleus
• It’s safe in pregnancy and doesn’t go to the placenta
• It doesn’t stay in the arm, it goes everywhere but that’s a good thing
• There is plasmid contamination but it’s only in small doses and there is no evidence that it causes any harm
• OK, it goes to the placenta but that means that the baby is protected too

-—[YOU ARE CURRENTLY HERE]—-

• OK it’s gene therapy but we’ve been using it for years and it’s been safe and effective with no adverse events identified after billions of doses.
• The LNP technology was brand new and hadn’t been tried but it’s been safe and effective with no adverse events identified after billions of doses.
• The same technology can be used for CRISPR gene editing which is now approved by the FDA and in combination with the LNP technology can be used to provide a permanent vaccine that you never need to get updated with boosters and repeated ouchie injections

Dr Ah Kahn Syed

March 26, 2025 – Writ of Mandamus Transferred to the Circuit Court of the Second Judicial Circuit, in and for Leon County, Florida – READ, ARCHIVE, Writ of Mandamus – (archive) PDF

• “The writ of mandamus outlines many laws being violated and contains bullet proof evidence compiled by Karen Kingston that the shots are weapons of mass destruction according to Weapons and Firearms § 790.166 Fla. Stat. (2023)”
• Zeee Media: Writ of Mandamus that has been served to Governor Ron DeSantis to immediately pull COVID mRNA injections off the market – Dr. Joseph Sansone & Karen Kingston – WATCH

March 25, 2024 – ICAN Challenges FDA’s Move to Weaken its Already Paltry Clinical Trial Requirements for Vaccine Approval – READ

• On September 11, 2023 the FDA published draft guidance stating that a single animal study could be sufficient to demonstrate a vaccine’s effectiveness! This means authorising new mRNA “vaccines” (because they class is now as a platform, not a product) without human studies – PDF, ARCHIVE
• “…on September 11, 2023, just one day before the committee met to clamp down on this “ineffective drug” with shoddy clinical trials, FDA issued draft guidance stating that, under certain circumstances, a manufacturer can show evidence of effectiveness for a biological product with a single clinical investigation conducted in animals, giving the example of “[w]hen the product is a preventive vaccine, and there is a well-established model of infection for a relevant infectious disease, and use of the vaccine in the animal model demonstrates prevention of disease.” Notably, this occurred shortly after FDA authorized the newest Pfizer COVID-19 vaccines, which are as Dr. Paul Offit notes, “new product[s],” even though Pfizer tested this brand-new shot only in mice—not humans.”
• ICAN submitted comment in opposition to proposed guidance – PDF
  • The “FDA has seemingly forgotten that its function is to regulate the pharmaceutical industry, not rubber stamp it.”
• [Remember the FDA claim that all vaccines “undergo a rigorous review of … clinical data to ensure the safety, efficacy, purity and potency of these products.”, is a “single animal study” adaquate to claim “rigorous”?]

March 20, 2024 – The Danish Medicines Agency states that chronic hives may be a side effect of the Spikevax vaccine – (Danish) READ, MSN – READ, CREDIT

• “Based on a total of 360 European cases, it is assessed that there is a ‘probable’ connection in 58 cases, while a ‘possible’ connection exists in 228 cases.”

March 19, 2024 – PharmaFiles Aussie17 Substack: Former Brazilian President Bolsonaro Caught in Fake COVID Vaccination Certificate Scandal – (Brazil’s Federal Police) Investigators retrieved two files named “bolsonaro.doc” and “laura.doc” from the printer, providing tangible evidence that the counterfeit vaccination certificates were printed – READ

• November 27, 2020 – Aljazeera: Brazil’s President Jair Bolsonaro says he will not take coronavirus vaccine – READ
• March 15, 2021 – Barrons: Brazil Orders 100 Million Doses Of Pfizer Vaccine and 38 million J&J doses, Health Minister Eduardo Pazuello secured a total of 563 million vaccine doses by the end of the year…”even as he confirmed that far-right President Jair Bolsonaro was looking at candidates to replace him amid a surge in new cases and deaths in Brazil.” – READ
• October 2, 2021 – RSBN: Brazilian President Jair Bolsonaro rips vaccine passports, warns against ‘population control’ – READ

March 18, 2024 – Ursula Edgington Substack: Revolving Doors of Power: Commercial NZ Health Group obtains 30% of all Granted Applications for ‘Vaccine’ Mandate Exemptions – 2 months later a Senior Government Manager is Appointed their CEO – READ

• 2467 staff of NZ Health Group were granted ‘vaccine mandate exemptions by an (anon) Gov Covid Exemption Panel
• CEO of NZ Health Group is Jane Kelley formally the NZ Ministry of Health’s ‘Director, National Controller’ for the ‘COVID-19 National Health Coordination Centre’

March 15, 2024 – ICAN: Second batch of Free Text field V-Safe data realesed – HERE, Highwire – WATCH, VAERSAware analysis – READ

March 11, 2024 – Bannons War Room Episode 3454: The Pandemic: 4 Years Later – Revisiting WHO DG 4 years ago, w/ Naomi Wolf – The WHO “product” launch – EXCERPT

We have …made the assessment that COVID-19 can be characterised as a pandemic. Pandemic is not a word to use lightly or carelessly. It’s a word that, if misused, can cause unreasonable fear or unjustified acceptance that the fight is over, leading to unnecessary suffering and death

WHO Director General Tedros Adhonom Ghebreyesus, 4 years ago, on March 11, 2020 [PDF]

March 8, 2024 – Epoch Times Zachary Stieber: CDC’s [communications on] long-term study of myocarditis after COVID-19 vaccination in response to FOIA- 148 pages fully Redacted – TWEET, “READ“, second document “is mostly redacted.”

• CHD: ‘Staggering’ Arrogance: Experts Rip CDC for Redacting All 148 Pages of Information on Myocarditis After COVID Shots – READ
• Russell Brand : CDC Caught Hiding BOMBSHELL Vaccine Data- WATCH
• March 15, 2024 – Peter McCullough testimony at Novel Coronavirus Southwestern Intergovernmental Committee (via Vigilant Fox) – WATCH
• Snopes “Fact Check” – READ

February 29, 2024 – America First Legal: America First Legal Sues HHS on Behalf of John Solomon to Uncover Secret Government Data About COVID-19 Vaccine Morbidity and Adverse Effects – READ, VAERS aware – CREDIT

• CDC/FDA only publishes initial VAERS reports “Primary Reports”, even though the system continues to capture follow-up data, the lawsuit is going after the “second set” of books!
• Before January 2011 VAERS WAS including follow-up data i.e. they added in the new data to the initial report. In late 2010 the Harvard Pilgrim Study report was released, which revealed “fewer than 1% of vaccine adverse events are reported”
• Also many people have filed a VAERS report and they have never been published.

Febraury 29, 2024 – Toby Rogers Substack: The economic crisis we face – What it means to live in the most extreme negative-sum game in history – READ

• The Great Poisoning as a business model and economic system – Re: RFK jr early 2020 speech: “Big Pharma globally makes about $50 billion a year from vaccines but then makes another $500 billion a year from treatment of vaccine injuries” [let that sink in!]

February 27, 2024 – United Australia Party: today’s Supreme Court ruling tha COVID-19 vaccine orders placed on Queensland frontline police and ambulance workers were unlawful, is a major victory for human rights – READ, Court judgement – PDF Nine News reports – WATCH

• The Court declared that the Police Commissioner’s direction issued on 7 September 2021 and 14 December 2021 were unlawful under section 58 of the Human Rights Act 2019. The court also ruled that the Employee COVID-19 Vaccination Requirements Human Resources Policy is of no effect.
• Queensland Police Commissioner resigned last week in anticipation of this landmark victory. Will Queensland Premier now step up and voluntarily compensate victims of vaccine injury and loss of work

February 21, 2024 – Nature: A 3D nanoscale optical disk memory with petabit capacity -Zhao – READ, Malone – CREDIT

• Chinese researchers have developed a new 3D optical data storage architecture that reaches petabit level capacity. Can store 24 times the data of most advanced hard disk drives, paving way for energy efficient, cost-effective exabit data centers.
• This technology will likely revolutionize virtual reality, robotics, AI, human augmentation (transhumanism), self driving vehicles, space travel and data center storage – REF

February 20, 2024 – Daily Mail: Largest Covid vaccine study ever finds shots are linked to small increased risk of neurological, blood and heart disorders – but they are still extremely rare – READ, Sen. Ron Johnson’s hearing Del Bigtree – EXCEERRPT

• “An international coalition of vaccine experts looked for 13 medical conditions among 99 million vaccine recipients across eight countries in order to identify higher rates of those conditions after receiving the shots.” where rare in this study is a 200-700x increase risk
• February 12, 2024 (preprint)- Vaccine Journal: COVID-19 vaccines and adverse events of special interest: A multinational Global Vaccine Data Network (GVDN) cohort study of 99 million vaccinated individuals – Faksova et al – READ

• The researchers identified 12 conditions that could be linked to various COVDI-19 vaccines. Among the most troubling included inflammation of the heart muscle and brain swelling – study from 99 million vaccinated.
• Define “rare”! In the COVID-19 protocols it was as often as 1 in 1000 doses – REF
• ABC Australia brings in Dr Norman Swan to comment on this study “all the side effects were rare” with respect to a rise about the base rate expected in the community. “They only chose significant side effects if they were confident they were side effects”…”its all about transparency so you know what the risks are” he says, yet the shots were mandated, and this “transparency” comes 3 years after rollout – WATCH
  • “This would be like winning the biggest lotto, 3 time in your life, something like that” says Dr Swan –EXCERPT

February 19, 2024 – Brighton Collaboration: 99 Million People Included in Largest Global Vaccine Safety Study – Global Vaccine Data Network (GVDN) assessed 13 neurological, blood, and heart related medical conditions – READ

• GVDN: Global COVID Vaccine Safety (GCoVS) – this project award totalled US$10,108,491 and is 100% funded by CDC/HHS – READ, ARCHIVE
• Published April 2, 2024 – Vaccine journal: COVID-19 vaccines and adverse events of special interest: A multinational Global Vaccine Data Network (GVDN) cohort study of 99 million vaccinated individuals – Faksova et al – READ

February 16, 2024 – Sonia Elijah Substack: France’s “Pfizer amendment” could turn mRNA critics into criminals – READ, Corbett Report – WATCH , CREDIT, The Law – READ

• On Feb 14, 2024 a highly controversial law was quietly passed with virtually no debate and pushed through the National Assembly in France, potentially turning a critic of mRNA treatment into a criminal, jailed up to 3 years and pay a hefty fine of 45,000 Euros.

February 16, 2024 – Select Subcommittee on the Coronavirus Pandemic | Assessing America’s Vaccine Safety Systems, Part 1 to examine the effectiveness of vaccine safety reporting and injury compensation systems following the rollout of the COVID-19 vaccine WATCH– Hearing Wrap Up: Americans Deserve Improved Vaccine Injury and Compensation Systems – READ & Watch highlights

• Malone Substack – [congress] still aren’t completely getting the level of corruption, censorship, psywar and regulatory capture. But last week’s hearing was a start. This committee is investigating this issue due to people like you and me contacting their representatives about vaccine injury and the cover-up. [Because the media aren’t reporting on it] – REF

February 16, 2024 – The Highwire: BREAKING: First look at the “Free-Text” COVID Vaccine Safety Data the CDC Wanted to Hide – READ, v-safe Dashboard – HERE

February 12, 2024 – Rebekah Barnett Substack: Australians abandon failed mRNA Covid shots- Fewer than 10% of Aussie adults are up-to-date – READ

• “Just 1.7 million, or 8.5% of Australia’s 20.1 million adults have had Covid booster in the past six months, according to the latest Australian Government update (as at 7 February)”

February 11, 2024 (published): Expert Opinion on Drug Safety: Lessons learned from COVID-19, H1N1, and routine vaccine pharmacovigilance in the United States: a path to a more robust vaccine safety program – Daniel Salmon, Robert T. Chen et al – READ

• “Vaccine pharmacovigilance is an essential component of vaccine safety programs. Vaccine pharmacovigilance refers to detecting uncommon adverse events following immunization (AEFI),…”

January 29, 2024 – PharmaFiles Substack: Slovak New Prime Minister Robert Fico BEGINS Investigation into COVID Management and Experimental Vaccines -recent parliamentary address – READ & WATCH

• November 27, 2023 – New Slovak PM Calls Out Big Pharma, Mainstream Media and the World Health Organization – READ (He took office Oct 25, 2023)
• “The Prime Minister delved into the retrospective evaluation of the pandemic response, positioning his stance clearly against the rapid adoption of what he described as “mass vaccination with untested experimental vaccines.“”

January 15, 2024 – Workers Compensation Landmark COVID-19 vaccine injury win – Precedent: employers are responsible for compensating employees who acquire vaccine injuries from work directives – Rebekah Barnett – READ, Sen. Rennick – TWEET, Pin Point – READ, Altman Substack – READ

• South Australian Empolyment Tribunal – Shepherd v The State of South Australia (in right of the Department for Child Protection) [2024] SAET 2 (15 January 2024) – READ
• Employment was “a significant contributing cause” to pericarditis

January 11, 2024 – The Highwire: Court forces CDC to release V-SAFE ‘Free-Text’ Data – data in addition to the limited check box data released in Oct 2022 – WATCH, first batch due Feb 15, 2024 – V-SAFE Dashboard – HERE

January 10, 2024 – The Aussie Wire: Big Pharma’s Dirty Secret: Rebekah Barnett Shines a Light on Covert Advertising! – WATCH, How Big Pharma harnesses our tax money and news media to market their drugs – READ

• Big Pharma cannot advertise on TV in many countries except USA & NZ, but they use as simple work around which use PR/press releases that are “picked up” by news agencies which then “advertise” the ‘problem, reaction, solution‘ to the public

January 9, 2024 – Epoch Times | Facts Matter: 8th Shot of mRNA Vaccine, and the Coming ‘Heart Failure Pandemic’ – WATCH, Vigilant Fox – CREDIT

• Latest dominant variant of SARS-CoV-2 is called JN.1, an offsping of earlier Omicron variant has where symptoms which mimic the seasonal flu
• December 27, 2023 – The Economic Times: Covid could trigger ‘heart failure pandemic’. Health experts warn of ‘global healthcare risk’ after New Year – READ
• December 26, 2023 – The Mainichi | Japan: Post-COVID ‘heart failure pandemic’ possible: Japan researchers – READ, ARCHIVE
  • Researchers at Japan’s Riken institute have warn “persistant infection of SARS-CoV-2 is expected to exponentially increase” but …”Even though conclusive clinical evidence that persistant SARS-CoV-2 infection is associated with declined cardiac function has not been reported so far…” [its a theory!]
  • “Researchers say it’s possible that some patients won’t develop heart failure even if the infection persists…”
• March 11, 2022 – Pfizer completes acquisition of Arena Pharmaceuticals for $6.7bn – a specialist in cardiac treatment products! – READ, ARCHIVE

2023

December 21, 2023 – Rebekah Barnett Substack: Australian medical regulator [AHPRA] finally relaxes Covid gag order on doctors – But doctors say the regulatory environment remains ‘hostile to individualised care’ – READ, TIMELINE,

• Phillip Altman Substack: DOCTORS CENSORED AND GAGGED FROM TRUTH TELLING -0 How essential post-approval pharmacovigilance was undermined by our government – READ
• Alison Bevege Substack: TGA tells Big Pharma to check Facebook and YouTube for gene-vax injuries while government tells social media to disappear those exact same report – AHPRA quietly removes doctor gag order as “superseded” while insane drug safety system breaks – but government entrenches the censorship – READ “AHPRA has now repealed that infamous March 2021 gag order.”

AHPRA has a real history of coming down really strongly on doctors.

Dr Melissa McCann (CREDIT)

December 13, 2023 – CHD The Defender: Canada Reports 300% Increase in ‘Unspecified Causes’ of Death, Sparking Calls for Investigation – READ

• “unspecified causes” of death from 2019-2022 is now fifth leading cause of death in Canada. Some health experts said the stark increase should trigger an investigation into whether the deaths are linked to COVID-19 vaccines.

December 12, 2023 – The Hill | Opinion Kory and Pfeiffer: This is bigger than COVID: Why are so many Americans dying early? – READ, FLCCC – CREDIT

• People are dying in abnormally high numbers even now and long since COVID-19 waned. Yet public health agencies and medical societies are silent.

December 12, 2023 – Vigilant News: Former Italian Health Minister Roberto Speranza Under Investigation for Murder for Concealing COVID-19 Vaccine Deaths – READ “He knew the shots were killing people and gave orders to local health authorities to conceal deaths and serious side effects.”

December 11, 2024 – ABC News: New COVID-19 vaccines targeting Omicron ‘Kraken’ subvariant XBB 1.5 are now available in Australia – READ

December 9, 2023 – Sen. Malcolm Roberts Australia: Have your say COVID-19 Royal Commission w/ Prof Ian Brighthope and Julian Gillespie – WATCH

• Legal and Constitutional Affairs Reference Committee for the appropriate Terms of Reference for a COVID-19 Royal Commission in Australia
• Jan 8, 2024: Club Grubbery Host a panel discussing the terms for reference for a royal commission into COVID-19 – WATCH

December 8, 2023 – CHD | Doctors & Scientists w/ Dr Hooker and Zoey O’Toole – The Terrifying Bioweapons Arms Race With Professor Francis A. Boyle – WATCH

• Boyle is an international lawyer and biowarfare expert of over 30 years – WATCH

November 30, 2023 – TEXAS: Attor­ney Gen­er­al Ken Pax­ton Sues Pfiz­er for Mis­rep­re­sent­ing COVID-19 Vac­cine Effi­ca­cy and Con­spir­ing to Cen­sor Pub­lic Discourse – READ, The Hill – READ, Reuters – READ

• “…alleging the company “misrepresented” the effectiveness of its widely administered COVID-19 vaccine” – REF

November 27, 2023 – PharmaFiles Substack: New Slovak Prime Minister Calls Out Big Pharma, Mainstream Media and the World Health Organization – READ & WATCH (He took office Oct 25, 2023)

• “The Prime Minister delved into the retrospective evaluation of the pandemic response, positioning his stance clearly against the rapid adoption of what he described as “mass vaccination with untested experimental vaccines.”

November 25, 2023 – PharmaFiles Substack: BREAKING: Philippines‘ House of Representative initiates a formal investigation into excess deaths! – READ & WATCH

November 19, 2023 – Expose News: 94% of COVID-19 Deaths over past year were among Quadruple Vaccinated – ONS data between 1st June 2022 and 31st May 2023 – READ

November 16, 2023 – Gateway Pundit: TOO LATE: US Army Removes COVID Vaccine Requirement for Recruits Following Historic Low in Recruitment Since 1973 – “as well as an increasingly woke military atmosphere where trans soldiers are give special privileges while Christian soldiers are persecuted” – READ

• Defense Secretary Lloyd Austin mandated the experimental COVID-19 vaccine for all military personnel on August 24, 2021 – TIMELINE

November 13, 2023 – “Injuries Caused by COVID-19 Vaccines” Hearing led by Rep Marjorie Taylor Greene – TEASER, WATCH, BACKUP, w/ Dr Robert Malone, Dr Kimberly Biss & Attorney Thomas Renz, CREDIT

• Vigilant Fox: OB-GYN Drops Alarming Miscarriage Data Before Congress: “I’ve Never Seen This Before” – Dr Kimberly Biss – READ, EXCERPT, Dr Rose Substack published data – HERE
• Vigilant Fox: Sen. Ron Johnson Shares the Most Censored Chart in Congressional History – WATCH, READ
• Welcome the Eagle: Attorney Tom Renz Drops The Biggest BOMB – October 2014 soldier received “COVID-19 immunization” re court records – WATCH

November 11, 2023 – Epoch Times: EXCLUSIVE: Millions of Breakthrough COVID-19 Cases in 2021, Epoch Times FOIA of U.S. CDC files show – i.e. vaccine failure – READ

• More than five million COVID-19 cases occurred in vaccinated people in 2021 – 1 million of those were by September 2021
• “The new files show that many of the breakthrough cases happened among the “fully vaccinated,” or people who tested positive at least 14 days after completing a primary series….The CDC quietly posted the data online in October 2022…The cases among the partially vaccinated were never posted online”
• “The breakthrough case counts were likely much larger than these 3.6% described in the FOIA data,” Dr. Risch said as post May 2021 CDC ONLY counted cases that led to hospitalization or death. “…at a time when CDC officials were making public statements that the vaccines completely prevented getting COVID”
• “The month with the most cases was December 2021. In that month, 2.7 million cases were identified among the fully vaccinated, and another 266,736 were recorded among the partially vaccinated.”

November 9, 2023 – The Telegraph: The real Covid jab scandal is finally emerging – The young and healthy, who were at minimal risk from Covid, should not have been told they had to take the vaccine – READ, ARCHIVE

November 5, 2023 – Sasha Latypova: Do C-19 Vax Manufacturers Violate cGxP? – Master class in pharmaceutical regulations: the difference between EAU and EUA that nobody on Earth has noticed in the past 3 years. Including me until yesterday afternoon. – READ

• Legally Emergency Use Authorisation (EUA) is not the same as Expanded Access Use (EAU)
• An EUA emercency counter measure under a declared Public Health Emergency by HHS Secretary that product “shall not be considered to constitute a “clinical investigation” – thus not subject to the rigors of an investigational new drug (IND) – such as receiving informed consent in trial or in population!
• “Legal preparedness” by FDA-CDC – “certain [pandemic] preparedness activities [without EUA + PREP Act shield] would otherwise violate the FD&C Act”– FDA August 25-27, 2020 – Slide 3 – PDF
• October 22, 2020 – VRPBAC meeting – FDA’s Doran Fink (now with Moderna!) – explains why EUA and not EAU regulatory pathway for the new technology jabs – EXCERPT See pg 201 onward in Transcript – PDF
  • [Note Dr. Gruber, Dr. Krause, and Dr. Weir, Dr. Fink – all in the same meeting. Gerber and Krause resigned Aug 2021 – TIMELINE]
  • Expanded access protocol (EAU) is another regulatory mechanism for providing access to investigational vaccine – EAU is carried out under FDA’s investigational new drug (IND) regulations- which requires amongst other things, obtaining informed consent from recipients of the investigational vaccine accorging to regulations for clinical investigations – pg 203, EXCERPT

The differences between expanded access use and Emergency Use Authorization are that expanded access use is done — or is carried out under FDA’s investigational new drug regulations. So among many other things, those regulations require use of an institutional review board and also obtaining informed consent from recipients of the investigational vaccine according to regulations for clinical investigations — research use of investigational vaccines. And so operationally speaking, an expanded access protocol would add some complexity, and that is why Emergency Use Authorization is being considered primarily as the mechanism for addressing the public health emergency that has been declared.

Dr Doran Fink

November 2, 2023 – Epoch Health: EXCLUSIVE: Some Scientists, Journals Pose ‘Potential Threats to Vaccine Confidence’: CDC – READ, Dr Malone – CREDIT

• “experiments have found multiple doses of the Pfizer and Moderna COVID-19 vaccines lead to higher levels of antibodies called IgG4, making the immune system more susceptible.” PAPER
• CDC concerned such publications pose “potential threats to vaccine confidence posed by select scientific journals and publishers.” – Dr Malone goes on to conclude “in other words the CDC clearly believes that it should be the sole arbiter of what should or should not be published concerning the vaccine industry and vaccine-related science.”

October 27, 2023 – CHD |The Defender: How Pfizer Hid Nearly 80% of COVID Vaccine Trial Deaths From Regulators – READ

• October 17, 2023 – IJVTPR: Forensic analysis of the 38 subject deaths in the 6-Month Interim Report of the Pfizer/BioNTech BNT162b2 mRNA Vaccine Clinical Trial – Flowers et al – READ
• “Pfizer failed to disclose evidence of more than a 3.7-fold increase in the number of cardiac deaths among vaccine recipients compared to those who received a placebo.: – REF

October 26, 2023 – ABC News: Getting flu and COVID shot together still reasonable amid safety review of potential stroke risk: Experts – READ [keep on jabbing!], OAN – CREDIT

• “Older adults who received last year’s COVID booster and a high-dose version of the flu vaccine in the same visit may have a potential increased risk of stroke, according to a new FDA-funded study.”
• October 15, 2023 – Preprint: Evaluation of Stroke Risk Following COVID-19 mRNA Bivalent Vaccines Among U.S. Adults Aged ≥65 Years – Lu et al – PDF

October 3, 2023 – NZ Docs Substack: Secret Vaccine Exemptions for Healthcare Workers in New Zealand Come to Light – READ An estimated 11,005 healthcare workers received a 12A vaccination Exemption in NZ.

• Official Information Act (OIA) request reveals From 13 November 2021 to 26 September 2022 (The NZ vaccine mandate period) “a total of 478 applications for Significant Service Disruption exemption (SSD) were received. 103 applications were granted, covering approximately 11,005 workers.” An organisation could submit an “application” which covered more than one person, thus 11,005 is only an “estimate” of the number of workers covered by the 103 applications granted. – READ
• Temporary Significant Service Disruption (SSD) Exemption – COVID-19 Public Health Response (Vaccination) Order (VO) 2021 clause 12A Exemption – application example Word doc – ARCHIVE

September 20, 2023 – The Dossier by Jordan Schachtel: Expensive poison: Top U.S. pharmacies charging $200+ a shot for new Covid “vaccines” – READ, New York Post – READ

• Latests booster unexpected out-of-pocket costs between $125 to $200 per shot, it’s no longer free

September 18, 2023 – Times Union: CVS and others cancel COVID-19 vaccine appointments due to insurance issues – READ

• Pharmacists advising clients to reschedule or risk paying $200 out-of-pocket cost for new booster “designed to target the latest coronavirus strains”, as “state officials warn that old vaccines do not provide immunity against more recent COVID-19 strains” As a comparison annual flu vaccine (Influenza) is ~$25 to $30 per dose.
• CDC recommends the now “single-dose vaccine, manufactured by Moderna and Pfizer…for anyone ages 6 months and older” – REF for the Omicron variant XBB.1.5
• Manufactures charged the US government $29/dose for previous booster.

September 13, 2023 – The Telegraph: People injured or bereaved by Covid vaccines ‘speak in code online over censorship fears’ – Official inquiry also heard NHS workers are afraid to talk about side effects ‘for fear of recrimination’ – READ, ARCHIVE, Russell Brand – EXCERPT

September 12, 2023 – CDC PRESS RELEASE: CDC Recommends Updated COVID-19 Vaccine for Fall/Winter Virus Season “to protect against the potentially serious outcomes of COVID-19 illness” with updated booster – READ

• They’re still promoting that “Vaccination remains the best protection against COVID-19-related hospitalization and death.”
• They also state “To date, hundreds of millions of people have safely received a COVID-19 vaccine under the most intense safety monitoring in U.S. history.” [we know that’s not true]

September 11, 2023 – FDA PRESS RELEASE: FDA Takes Action on Updated mRNA COVID-19 Vaccines to Better Protect Against Currently Circulating Variants – READ , TIMELINE

• FDA approved and authorised the “emergency use updated COVID-19 vacciens formulated to more closely target currently circulating variants and to provide better protection against serious consequences of COVID-19, including hospitalization and death.”
• These “updated mRNA vaccines for 2023-2024 manufactured by ModernaTX Inc. and Pfizer Inc. … have been updated to include a monovalent (single) component that corresponds to the Omicron variant XBB.1.5.

August 5, 2023 – PrePrint: Unnaturalness in the evolution process of the SARS-CoV-2 variants and the possibility of deliberate natural selection by Tanaka and Mizazawa – READ, PDF, CREDIT

• “The following results presented in this study may support the hypothesis that the Omicron variants may have been artificially synthesized rather than naturally occurring”.

July 22, 2023 – Epoch Times: EXCLUSIVE: CDC Changed Definition of Breakthrough COVID-19 After Emails About ‘Vaccine Failure‘ – READ,

• On February 2, 2021 the CDC altered its definition of a COVID-19 breakthrough case for a vaccinated person to include only cases detected at least 14 days after a primary series (2 doses), leading to preceived lower number of cases classified as a breakthrough, according to FOI documents obtained by The Epoch Times
• [Meaning if a person who’s immune system was altered by one or two of the COVID-19 injections and making them more susceptible to contracting the circulating SARS-CoV-2 virus as a consequence, then these PCR positive cases would be noted as “unvaccinated” individuals and not a “breakthrough case”. This provided fuel for the CDC, Fauci, Biden and media to push a “pandemic of the unvaccinated” narrative.]

July 1, 2023 – Brownstone Institute: German Scientists Uncover Evidence that EU Pfizer-BioNTech Batches Included Placebos – READ, Jan 2024 followup “…all but one of the “yellow” batches had not been subject to quality control testing” – READ

• “German scientists have uncovered startling evidence that a substantial portion of the batches of the Pfizer-BioNTech Covid-19 vaccine deployed in the European Union may in fact have consisted of placebos – and hence were not even subjected to quality-control testing by the German agency which was in principle responsible for approving their release.”

April 2, 2023 – PANDA: It is impossible that the vaccines saved 14 million lives in 2021 – READ

• “An estimate in the Lancet that Covid-19 vaccinations prevented 14.4 million deaths is so impossibly high that the error should have been recognised.”
• The Lancet Study: June 23, 2022 (pub date) – Global impact of the first year of COVID-19 vaccination: a mathematical modelling study – Watson et al – READ
  • The paper states “Based on official reported COVID-19 deaths, we estimated that vaccinations prevented 14·4 million (95% credible interval [Crl] 13·7–15·9) deaths from COVID-19 in 185 countries and territories between Dec 8, 2020, and Dec 8, 2021.” [Remember “official” COVID-19 death can also be just “assumed” [1, 2, 3, 4, 5]]

March 10, 2023 – Kaiser Family Foundation (KFF): How Much Could COVID-19 Vaccines Cost the U.S. After Commercialization? – READ

• “The federal government has spent more than $30 billion on COVID-19 vaccines, including the new bivalent boosters, incentivizing their development, guaranteeing a market, and ensuring that these vaccines would be provided free of charge to the U.S. population.”
• “Federal Purchases of Pfizer and Moderna COVID-19 Vaccines have Totaled $25.3 Billion at an Average Price of $20.69 per Dose”

March 7, 2023 – KFF Polling: The COVID-19 Pandemic: Insights from Three Years of KFF Polling – READ, CREDIT (About KFF – READ)

• Trust in public health officials declined over the course of the pandemic
• “Misinformation about health care topics is nothing new, but social media, the polarization of news sources, and the pace of scientific development on COVID-19 all contributed to an environment that made it easier than ever for misinformation and deliberate disinformation to spread. In late 2021, nearly eight in ten adults said they had heard at least one of eight different false statements about COVID-19 and that they believed it to be true or were unsure if it was true or false. Unvaccinated adults were more likely to report believing COVID misinformation than those who are vaccinated.”
• See Poll Chart below. I’ve numbered the questions and provided links to pages with more information for you to decide what is a “false statement”
  • Q1: – Exaggerating deaths attributed to COVID-19 – Death Certificates – HERE, FOIA’d COD – HERE, Remdesivir – HERE, End of Life protocol – HERE, Unvaccinated means vaccinated but not “fully vaccinated” in US hospitals – HERE
  • Q2: – CV-19 vaccine during pregnancy – HERE, The Pfizer papers – HERE, Infertility and menstrual issues – HERE
  • Q3 – Death following CV-19 vaccine many links – HERE, VAERS reports deleted or throttled – HERE, Vaxxed 3 documentary testimonials – WATCH
  • Q4 – Infertility issues – HERE and fertility issues found in the Pfizer FOIA Documents – HERE, Dr James Thorpe – HERE
  • Q5 – Info on Ivermectin (incl. documentary links) – HERE, Dr Pierre Kory – HERE, Dr Paul Marik – HERE, Dr Tess Lawrie – HERE
  • Q6 – “You can get COVID-19 from the vaccine” is a deceptive question, it needs nuance. COVID-19 is a dis-ease, a collection of symptoms attributed to/caused by the pathogen called SARS-CoV-2. Symptoms may also be attributed to just the effects of the mass production of the SARS-CoV-2 spike protein which the CV-19 mRNA vaccines forces your body to manufacture. The Cleveland Study has shown that the more booster shots received the greater chance of contracting COVID-19 (susceptibility), or registering a positive PCR test – READ, More on vaccine effectiveness – HERE, Dr Geert Vanden Bossche – HERE
  • Q7 – COVID-19 vaccines contain a microchip. This again should be nuanced (‘cos we don’t know what is in these brand new jabs!), as there certainly are some strange self-assembling findings in the vaccine vials – HERE, and the early magnetic phenomenon – HERE, plus there have been bluetooth phenomenon such as this – WATCH. How would you track the mass vaccinated population? – WATCH, The micro-chip theory stems from an interview with the late Ricado Rossi who spoke about the Rockefellers wanting to microchip the world – WATCH
  • Q8 – The regulators have ignored the potential for these genetic products to alter DNA. DNA contamination and SV40 promoters are real. More information HERE, Dr Jessica Rose – HERE, Dr Kevin McKernan – HERE, Prof Angus Dalgleish – HERE, Australia’s Port Hedland Council – TIMELINE, Turbo Cancer – HERE, Dr Ryan Cole – HERE

2022

November 17, 2022 – Vaccination is Political | Elizabeth Hart: Letter from the Australian Federal Government, Department of Health and Aged Care in reply to Elizabeth Hart Inquiring about Medical Indemnity for health professionals administering the COVID-19 vaccines and Informed Consent – Letter PDF, SOURCE

• On behalf of the Hon Mark Butler MP, Minister for Health, it was confirmed, in writing, that:
  • The former Government established the no-fault Scheme (NFS),which commenced operations on December 13, 2021, instead of a medical indemnity scheme. The NFS was to encourage “increased participation” of healthcare.
  • Stated: “Informed consent should be obtained for every COVID-19 vaccination, as per usual consent procedures for other vaccinations.“
• September 20, 2021 AHPRA responded to similar request regarding informed consent – PDF

October 10, 2022 – Gateway Pundit: BREAKING BIG: Pfizer Director Admits Vaccine was Never Tested on Preventing Transmission During European Union Parliament Hearing Contrary to Previous Claims – READ, News.com.au – READ, Dr Campbell: Viral transmission not tested in Pfizer trials – WATCH, TIMELINE

• Pfizer CEO didn’t turn up, but Jeanine Small was sent. She was questioned by Dutch MEP Rob Roos – WATCH

“NO…we had to really move at the speed of science…[and] we had to do everything at risk“!

Janine Small, Pfizer’s president of international developed markets

August 24, 2022 – Epoch Times: EXCLUSIVE: Vaccinated Making Up Higher Proportion of COVID-19 Metrics in US – Vaccinated people are more likely than the unvaccinated in recent months to be a COVID-19 case, hospitalization, or death in 25 states, according to an Epoch Times investigation. – READ

August 5, 2022 – Epoch times: 10 Percent of Americans Regret Taking COVID Vaccine, 15 Percent Have a New Medical Condition After It: Poll – READ, SOURCE

March 7, 2022 – COVID Medical Network: LETTER to Chair, Australian Therapeutics Advisory Group on Immunisation (ATAGI) and other Australian government public health officials – lays out a wealth of evidence to stop the jabs – PDF, AVN- CREDIT

2021

December 20, 2021 – TGA grants provisional determination to Vaxine Pty Ltd [Petrovsky‘s vaccine from South Australia] for its COVID-19 recombinant protein vaccine – in relation to their COVID-19 vaccine, Recombinant CoV-2-S-ΔTM protein with Advax-CpG55.2 – READ, ARCHIVE

December 16, 2021 – CDC Media Statement: CDC Endorses ACIP’s Updated COVID-19 Vaccine Recommendations – ARCHIVE

• CDC has updated its recommendations for COVID-19 vaccines with a preference for people to receive an mRNA COVID-19 vaccine (Pfizer-BioNTech and Moderna) – REF over Johnson & Johnson’s COVID-19 vaccine

November 24, 2021 – NPR: COVID vaccines are set to be among the most lucrative pharmaceutical products ever – READ, Yahoo – READ

November 23, 2021 – Taipei Times: Medigen to apply to Australian agency for provisional approval of its vaccine – READ – the sixth firm to gain a “provisional determination” by the TGA.

• “Medigen Vaccine Biologics Corp … apply to the Australian Therapeutic Goods Administration (TGA) for provisional approval of its COVID-19 vaccine in the near term, after obtaining a provisional determination from the agency.”
• August 2021 – MVB Announces Launch of Its COVID-19 Vaccine MVC-COV1901 Adjuvanted with Dynavax’s CpG 1018 Adjuvant – READ, Medigen received Taiwan Emergency Use Authorization and approval for inclusion in Taiwan’s COVID-19 vaccine immunization program in July 2021
• The submission was made by Grand Pacific Cro Australia (the Australian sponsor acting on behalf of Medigen Vaccine Biologics (MVB) Corp Taiwan ) to register MVC COVID-19 Vaccine (MVC-COV1901) 15 μg/0.5 mL  – The MVC COVID-19 vaccine is a protein subunit vaccine consisting recombinant form of the SARS-CoV-2 spike (S) protein. This is adjuvanted with CpG 1018 (cystosine phosphoguanine 1018) and aluminium hydroxide, acting as adjuvants which enhance recognition by the innate immune system.
• “For active immunisation to prevent novel coronavirus disease (COVID-19, also known as severe pneumonia with novel pathogens)” – TGA AusPAR Sept 2023 – PDF

November 10, 2021 – BBC: Covid-19: Vaccines to be compulsory for frontline NHS staff in England – READ

• Sajid Javid said the move would help protect patients and the NHS as a whole – More than 93% of NHS frontline staff have had their first dose and 90% are fully vaccinated – government considering whether “Covid and flu jabs should be compulsory
• No unvaccinated worker should be “scapegoated or shamed”, said Mr Javid, and should instead be supported to make “a positive choice” [??]
• “There are already more than 90,000 vacancies in the NHS in England. It is a number that has actually fallen during the pandemic after staff put off retiring to help out.
• If those staff take up their option to retire and mandatory vaccination forces others out, the NHS could find itself severely short of staff come the spring.”

November 10, 2021 – LifeSite News: Bayer executive: mRNA shots are ‘gene therapy’ marketed as ‘vaccines’ to gain public trust – READ

• ‘We probably would have had a 95% refusal rate’ for these shots two years ago, but the pandemic and marketing of the injections as ‘vaccines’ has made them popular with the public, said Stefan Oelrich at the October 2021 World Health Summit – (@1h30m) WATCH,

October 15, 2021 – CDC: COVID-19 vaccines are effective at protecting you from getting sick. – ARCHIVE

February 23, 2021 – Vaccine journal: Vaccine-associated enhanced disease: Case definition & guidelines for data collection, analysis, and presentation of immunization safety data – Munoz et al – READ

• This is a Brighton Collaboration Case Definition of the term ‘‘Vaccine Associated Enhanced Disease” [VAED] to be utilized in the evaluation of adverse events following immunization.

• “By late February 2021, a group of experts called Brighton Collaboration released a paper, which was published in Vaccine, clearly defining Vaccine-Associated Enhanced Disease (VAED), which is a more severe clinical presentation of a disease in a person vaccinated against that disease than would normally be seen in an unvaccinated person.” – REF

February 21, 2021 – ABC: Jane Malysiak becomes Australia’s first recipient of COVID-19 vaccine (Pfizer mRNA) along with PM Scott Morrison – READ, READ, The Guardian vaccine rollout – TIMELINE

• March 14, 2021 – Jane Malysiak becomes first Australian to be fully vaccinated – READ
• February 1, 2022 Jan Malysiak recived a booster (3rd shot!) with Scott Morrison in a photo opp. amid COVID-19 outbreaks in Sydney aged care facilities – READ, Janu 2022 -Outbreaks exceed 170 cases in four Sydney aged care homes – READ [the more jabs you get the greater your chance of getting infected with SARS-CoV-2! – Cleveland clinc studies]

2020

December 18, 2020 – BBC: Covid vaccines: Will drug companies make bumper profits? – READ

December 2, 2020 – Independent UK: Coronavirus vaccine: Pfizer given protection from legal action by UK government – Pfizer’s UK boss refuses to explain why the business needs protection from legal action – READ

• Ministers changed the law in recent weeks to give new protections to companies such as Pfizer, giving them immunity from being sued by patients in the event of any complications.

December 2, 202 – UK’s MHRA authorises Pfizer/BioNTech COVID-19 vaccine – Government authorises first COVID-19 vaccine on independent advice of medicines regulator – READ, TIMELINE

• The Joint Committee on Vaccinations and Immunisations (JCVI) will shortly publish its final advice for the priority groups to receive the vaccine, including care home residents, health and care staff, the elderly and the clinically extremely vulnerable.

December 1, 2020 – Swissinfo: Incomplete data stalls Swill authorisation of COVID-19 vaccines -Switzerland’s medical regulator Swissmedic says it lacks the necessary information to sign off on Pfizer/BioNTech, AstraZeneca, and Moderna vaccines ordered by the government – important data on safety, efficacy and quality are still missing – READ, CREDIT

November 18, 2020 – Bloomberg: Vaccine Safety to Remain Unclear Until Millions Get Their Shots – falling onto CDC and FDA – READ, ARCHIVE, The Highwire – CREDIT

September 4, 2020 – USA Today: Exclusive: Two-thirds of Americans say they won’t get COVID-19 vaccine when it’s first available, USA TODAU/Suffolk Poll shows (only 33% say yes) – READ

August 28, 2020 – WHO | R&D Blueprint team: Draft landscape of COVID-19 candidate vaccines – ARCHIVE, PDF

June 4, 2020 – WHO : WHO Director-General’s remarks at GAVI replenishment – ARCHIVE

Dr Jenner gave birth to one of the most powerful tools in the history of medicine. Thanks to vaccines, hundreds of millions of deaths have been prevented….

But all this progress is under threat. The COVID-19 pandemic is unravelling many of the gains we have made...

A vaccine will be essential for controlling COVID-19.

But vaccines only realize their true power when they are deployed to protect the poorest and most vulnerable…

Our shared duty is to ensure that once a vaccine is available, it is available to everyone.

Smallpox was not ended by a vaccine alone. There was one other key ingredient: solidarity.

Now is the moment for the world to come together in solidarity to realize the power of vaccines for everyone.

Now is the moment for all of us to fully fund Gavi to ensure it continues to prevent, protect and prosper.

Tedros Adhanom Ghebreyesus, WHO DG

June 4, 2020 – Global Vaccine Summit – world leaders pledge donations for COVID-19 pandemic – ARCHIVE, TIMELINE

June 2, 2020 – The Washington Post: 7 in 10 Americans would be likely to get a coronavirus vaccine, Post-ABC poll finds. – (70% say yes) – READ

April 1, 2020 – WHO: Immunization Agenda 2030: A Global Strategy To Leave No One Behind – READ, CSIC –READ, ARCHIVE

• As the global community wraps up the Decade of Vaccines (2010-2020), a new WHO-led plan, Immunization Agenda 2030 (IA2030) is launched – [by the end of 2020 the world is now armed with new vaccine technology!!]

2006

December 18, 2006 – Biosecurity and Bioterrorism: Disease Mitigation Measures in the Control of Pandemic Influenza – Inglesby et al – READ Patrick Frank comments – CREDIT

• “every single thing the CDC and Feds were doing to deal with the [COVID-19] pandemic was exactly the opposite of recommended protocols.”

The post COVID-19 vaccine news and trends first appeared on Totality of Evidence.

A case of COVID-19 “positive” did not mean the person was sick or infections (or even had the virus!). Before the pandemic, a test was normally performed on someone to confirm a diagnosis that a doctor had drawn form existing symptoms – at diagnostic test normally came AFTER symptoms. During the pandemic PCR testing, with amplifications dialled up over 35 cycles up to 45 cycles, created a “casedemic” of false positive statistically ill persons, which these daily advertised chart used to scare the uninformed populations of the world.

This page will collect links to article, papers and videos piecing together the PCR story, from those who were trying to get the message out about it’s misuse, as well as what public health officials were communicating. It will never be complete but is an attempt to capture and organise this historical information.

• PCR specific data points pulled from the COVID-19 Pandemic timeline – HERE

Some background on Polymerase Chain Reaction (PCR)

Not a “test” but a lab technique

In October 2004 the National Institute of Health Genome division defined polymerase chain reaction (PCR) as “A fast, inexpensive technique for making an unlimited number of copies of any piece of DNA. Sometimes called “molecular photocopying”. So not a test, but a lab technique for amplifying genetic material. [1, 2]

PCR redefined as a “diagnostic test”

By 2020 PCR was redefined as a “Diagnostic Test“. A test to diagnosed a disease, including a symptom-less disease (asymptomatic). A “test” that has been adopted globally to diagnose the disease COVID-19, and thus create the “case” statistics.

A test that amplified a small genetic section of a computer “virus” sequence, where the presence of this small segment was said to prove that someone was “diseased”, or “ill” with COVID-19.

The justification for mass testing everyone, stems from the allegedly phenomenon that healthy individuals showing no symptoms (asymptomatic), could be carriers and spread the virus unknowingly (super-spreaders) to everyone including the vulnerable members of the population – no matter how little viral load they may or may not have.

If someone has an intact immune system and/or had recently recovered from the viral infection, any trace of RNA in their nasal passage could produce a positive result with PCR, it is that sensitive! Contamination during nasal swabbing in carparks could also result in a positive result.

As prophylactic treatments and early treatments were taken off the board by authorities, it magnified the health authorities justification for ‘test, test, test’, as they wanted to ensure isolation of asymptomatic individuals, because the vulnerable allegedly had “no protection” until a miracle vaccine could become available.

The goal posts relating to “PCR testing” guidelines (i.e. the cycle threshold (Ct) changed after the COVID-19 vaccines rolled out. The higher the cycles above ~28, were highly likely to return a positive PCR result.

Every time the test is cycled, the genetic material doubles in quantity

PCR is designed as an laboratory tool to amplify quantities of DNA.

Every time the PCR is ran through a “cycle” the primers pick up complimentary genetic material, if present, and then duplicates- “number of DNA molecules can roughly double in each round of cycling.” There are also primers for fluorescent labelling – so when there is enough quantity present the machine can detect the fluorescence.

There needs to be a certain quantity to register as a fluorescence on the machine. If you cycle enough times, eventually you’ll get a ‘positive’ result for an initial genetic fragment – which would be meaningless.

Table 1 shows a doubling effect, starting with the example of just one “fragment” that contains the genetic sequence you are looking for, and how that quantity can potentially expand with each “cycle”.

Look at the quantity for 28 cycles vs 35 vs 45. Dr Fauci said anything greater than 35 cycles is likely dead nucleotide – thus not infectious, it can’t be cultured! He also states the threshold number (Ct) is not provided with the test result unless you ask for it! Knowledge of the number of cycles use to detect a positive result, can help determine the reliability of that positive result

“…with PCR, if you do it well you can find all most anything in anybody“

Kary Mullis circa 1993

CDC initial PCR instructions (35 then 40 cycles)

On January 24, 2020 the CDC put out instructions for use of RT-PCR, for “the in vitro qualitative detection of 2019-Novel Coronavirus (2019-nCoV) in respiratory specimens and sera.”

Under Interpreting Test Results it states “RP should be positive at or before 35 cycles for all clinical samples and HSC, thus indicating the presence of sufficient nucleic acid from human RNase P gene and that the specimen is of acceptable quality.” – PDF. By February 4, 2020 the PCR threshold was changed to <40 cycles. – PDF

November 2020 – The Highwire Ep 188: COVID TESTING FRAUD UNCOVERED – WATCH

Other consequences of the PCR testing procedure

Before we even get to run the test in the lab, the sample has to be collected. There is a whole host of issues here which I’ll also collect links to, for example:

• Why swab deep into the nasal passage when a mouth swab will suffice?
• The synthetic swabs are sterilised with the ethylene oxide – a known carcinogen
• The synthetic fibre from the swab could sluff-off in the nasal passage
• Cranial injuries occur – for asymptomatic children and adults
• What about that DNA harvesting? Did you give permission?

Other PCR Resource Sites:

• PCR Claims – HERE
• Corman-Drosten Review – ARCHIVE, HERE
• Swiss Policy Research – The Trouble With PCR Tests – HERE
• Health Canada: Polymerase chain reaction (PCR) and cycle threshold (Ct) values in COVID-19 testing – READ, ARCHIVE

PCR related links in reverse chronological order

This content will be updated as time permits

2024

March 16, 2024- Norman Fenton: Helping understand what ‘false positives’ in diagnostic testing really mean – WATCH, READ

• Many still fail to understand the ‘elephant in the room’ – the impact of the underlying population infection rate.

2023

November 13, 2023 – ICAN: Documents Reveal CDC Was Quietly Giving Advice on How to Handle Breakthrough Infections in March 2021 – READ, TIMELINE

• March 2021 – California’s health department alerted the CDC that it was fielding “many calls” for advice on instances of breakthrough infection. i.e.vaccine failure, yet CDC pushed the vaccine worked!
• In May 2021, CDC was given data showing that over 50% of fully vaccinated assisted living facility residents in a California facility tested positive for COVID-19, some of whom were hospitalized or died within just three months of their second dose. i.e. vaccine failure

September 27, 2023 – Australian Bureau of Statistics: COVID-19 first infectious disease in top 5 causes of death since 1970 – READ [REALLY!! – FOIA the death certificates]

• “COVID-19 was the third leading cause of death in 2022, accounting for more than one in 20 deaths (9,859 of 190,939 deaths), according to figures released today by the Australian Bureau of Statistics (ABS).”
• Senator Rennick: “TGA won’t even release the primer sequences used in PCR testing to prove that other strains aren’t being identified as Covid.” – TWEET
• [why in 2022 and not 2020-21?, when we now know the vaccine increases risk of contracting the virus, see June 12, 2023 – HERE]

September 6, 2023 – Epoch Health: People Rarely Transmit COVID-19 Before Experiencing Symptoms: Lancet Study – READ, ARCHIVE, The Lancet – READ

• A blow to the “silent spreader”, super spreader, asymptomatic narrative – which without highly amplified false positive PCR you’d never “know”
• The Lancet: Viral emissions into the air and environment after SARS-CoV-2 human challenge: a phase 1, open label, first-in-human study – Zhou et al – READ, ARCHIVE
  • “Very few emissions occurred before the first reported symptom (7%) and hardly any before the first positive lateral flow antigen test (2%),”..

August 4, 2023 – Daily Mail: Thousands of Americans potentially exposed to toxic Covid and pregnancy tests made at Chinese-run biolab in California – READ (not PCR but test kits!)

May 18, 2023 – Norman Fenton Substack | Where are the numbers?: The Covid testing swabs debacle – The ritualistic humiliation and pain was all part of the test of compliance and control – READ

March 16, 2023 – Ann R Coll Surg Engl.: COVID-19 nasopharyngeal swab and cribriform fracture by Vasilica et al – READ, CREDIT

• “non-trivial number” of these swab tests were “associated with skull base injury”

February 24, 2023 – FDA News Release: FDA Authorizes First Over-the-Counter At-Home Test to Detect Both Influenza and COVID-19 Viruses – READ [Not PCR, but “diagnostic” test]

January 30, 2023 – Journal of Neurosurgery” Case Lessons: Cerebrospinal fluid fistula as a complication of reverse transcriptase-polymerase chain reaction collection for the detection of coronavirus disease 2019: illustrative cases – Palavani et al – READ, CREDIT

2022

December 18, 2022 – Health.com: Can Anal Swabs Be Used to Test for Coronavirus? – Nose and throat swabs are standard in the U.S – READ – Timeline of the anal swab research

• April 13, 2022, Stanford Medicine STUDY SARS-CoV-2 infected people can shed viral genetic material in their feces for up to 7 months after diagnosis. “The study added to mounting evidence that the SARS-CoV-2 virus actively infects the gut”

2021

November 14, 2021 – The Telegraph: Covid test firm ‘to sell swabs carrying customers’ DNA’ – Cignpost Diagnostics, a government-approved supplier, prompts investigation over sharing of sensitive medical data with third parties – READ, ARCHIVE, CREDIT

October 28, 2021 – Journal of Surgical Case Reports: Cerebrospinal fluid leak post COVID-19 nasopharyngeal swab for a patient with idiopathic intracranial hypertension: a case report – Asiri et al – READ, CREDIT

July 27, 2021 – Reuters: Fact Check-COVID-19 nasal swabs sterilised with ethylene oxide are safe to use – READ, CREDIT

April 5, 2021 – Very Well Health: New COVID-19 Antibody Test ‘Glows’ When Antibodies Are Present – READ [Antibody not virus but putting here]

• The test, called SATiN (which stands for Serological Assay based on split Tripart Nanoluciferase), uses an enzyme called luciferase (the same enzyme that makes fireflies glow). [Intentional acronym?]
• March 22, 2021- Nature: A homogeneous split-luciferase assay for rapid and sensitive detection of anti-SARS CoV-2 antibodies by Yao et al – READ
  • This proof-of-principle study suggests potential applications in diagnostics, as well as disease and vaccination management.

January 27, 2021 – Guardian: China starts using anal swabs to test ‘high-risk’ people for Covid – READ, Reuters – READ, CTV News – READ, Health.com – READ

January 23, 2021 – Peoples Daily | China: Why does nucleic acid testing increase anal swab sampling? Expert Interpretation – (Chinese) READ, CREDIT [Google translator used]

• “Studies have found that the duration of positive nucleic acid in feces or anal swabs of some infected people is longer than that in the upper respiratory tract. Therefore, increasing the nucleic acid detection of anal swabs can increase the detection rate of infected patients and reduce missed diagnoses….At present, anal swab collection is only for key groups.”
• “only throat swabs and anal swabs are collected at the same time for key populations such as isolation points….The purpose of doing so is to increase the detection rate and reduce the probability of false negatives.”
• “In January of 2021, after localized COVID-19 outbreaks in parts of China, including the capital city Beijing, authorities started using anal swabs to test for the virus instead of the usual nose and throat swabs” – REF

DATE? – How the Unscientific Interpretation of RT-PCR & Rapid Antigen Test Results is Causing Misleading Spikes in Cases & Deaths Written By Yohan Tengra & Ambar Koiri for Awaken India Movement (full of references) – PDF

2020

December 17, 2020 – Journal of Clinical Infectious Disease: Predicting Infectious Severe Acute Respiratory Syndrome Coronavirus 2 From Diagnostic Samples – Bullard et al – READ, CEBM – READ, CREDIT

• SARS-CoV-2 Vero cell infectivity of respiratory samples from SARS-CoV-2 positive individuals was only observed for RT-PCR Ct < 24 and symptom onset to test of < 8 days. – REF
• Infectivity of patients with Ct >24 and duration of symptoms >8 days may be low.

December 4, 2020 – Medical Journal of Australia: The COVID swab and the skull base – how to stay safe – Mistry et al – READ

• “The mass testing program during COVID-19 has seen vast numbers of nasal and nasopharyngeal swabs performed. We present an extremely rare case of skull base injury and CSF leak with subsequent meningitis, occurring as a complication of a COVID-19 diagnostic swab.” [rare?]

December 2, 2020 – Peak Prosperity w/ Chris Martensen – The lockdowns are based on surging “cases” which are based on positive PCR test results – explanation of PCR Cycle Thresholds (Ct) – WATCH, BACKUP, BACKUP

November 27, 2020 – Corman Drosten Review: Review report Corman-Drosten et al. Eurosurveillance 2020 – ARCHIVE

• External peer review of the RTPCR test to detect SARS-CoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive results. by Borger, Yeadon, Craig, McKernan et al

November 6 , 2020 – Corona Investigative Committee: Sitzung 26: PCR-Test – die Dominosteine fallen (German) – ARCHIVE

November 5, 2020 – The Highwire Ep 188: Lighting the Way – “covid is over” – FULL, COVID TESTING FRAUD UNCOVERED – WATCH

• Del walks through April 27, 2020 paper by Didier Raoult et al – READ, and shows that a PCR test amplified to 33 cycles returns a false positive 80% of the time, so it is only 20% accurated for the potential presence of viable, infectious virus!
• October 31, 2020 – CNN: US coronavirus cases surpass 9 million driven by ‘silent epidemic’ of asymptomatic infections – READ – As Del Bigtree explains – asymptomatic are not carries, nor are they infections as the US labs set their threshold for cycling the tests at 45 Ct – WATCH

November 2020 (?) – Corman Drosten Review: The consequences of false positives – ARCHIVE

October 31, 2020 – CNN: US coronavirus cases surpass 9 million driven by ‘silent epidemic’ of asymptomatic infections – READ – As Del Bigtree explains – asymptomatic are not carries, nor are they infections as the US labs set their threshold for cycling the tests at 45 Ct – WATCH

October 26, 2020 – from The Highwire: TOP DOC CONFIRMS: COVID IS OVER – featuring Dr Mike Yeadon @MichaelYeadon3 statement Twitter – WATCH , Twitter – ARCHIVE, also on The Highwire – WATCH

I think the PCR test at present is throwing up so many false positves that in fact we’re mis-diagnosing the cause of the deaths that are being reported. The number of deaths that are occurring at the moment is normal for the time of year.

Dr Mike Yeadon

September 29, 2020 – The Lancet Respiratory Medicine | Comment: False-positive COVID-19 results: hidden problems and costs by Surkuva et al – READ, CREDIT

September 28, 2020 – Clinical Infectious Disease | Correspondence: Correlation Between 3790 Quantitative Polymerase Chain Reaction–Positives Samples and Positive Cell Cultures, Including 1941 Severe Acute Respiratory Syndrome Coronavirus 2 Isolates by Faafar et al – READ

• “It can be observed that at Ct = 25, up to 70% of patients remain positive in culture and that at Ct = 30 this value drops to 20%. At Ct = 35, the value we used to report a positive result for PCR, <3% of cultures are positive.”

August 29, 2020 – New York Times: Your coronavirus test is positive. Maybe it shouldn’t be. The usual diagnostic test may simply be too sensitive and too slow to contain the spread of the virus – READ, CREDIT

• “Most tests set the limit at 40, a few at 37 [Ct]…The CDC’s own calculations suggests that it is extremely difficult to detect any live virus in a sample above a threshold of 33 cycles.
• Officials at some state labs said the CDC had not asked them to note threshold values or to share them with contact-tracing organizations” [the logical thing that should have been done to help determine accuracy of test results]
• Thermo Fisher COVID-19 tests “automatically classifies results based on a cut-off of 37 cycles…testers did not have access to the precice numbers”
• “In Massachusetts, from 85 to 90 percent of people who tested positive in July with a cycle threshold of 40 would have been deemed negative if the threshold were 30 cycles, Dr. Mina said. “I would say that none of those people should be contact-traced, not one,”’
• “85 to 90 % of people who tested positive in July 2020 with a cycle threshold of 40 would have been deemed negative if the threshold were 30 cycles, Dr. Mina said. “I would say that none of those people should be contact-traced, not one,”

August 18, 2020 – PNAS: Haplotype networks of SARS-CoV-2 infections in the Diamond Princess cruise ship outbreak by Sekizuka et al – READ, PANDA – CREDIT

• The examination of 900 swab samples taken onboard the Diamond Princess passengers and crew February 15 to 17, 2020 “indicates no correlation between Ct value of positive tests, symptomatic vs asymptomatic, or even symptoms vs positive tests. Clearly this sheds some doubt on whether those specimens considered positive really were of live infections, and whether those with symptoms (but testing negative) were actually suffering from Covid-19. In a documentary with footage largely sourced from passenger and crew cell phones, not a single person appeared ill, including some passengers evacuated to hospitals.” PANDA – REF
• 43 people had COVID-19 symptoms, but tested negative, 125 had no symptoms but tested positive!
• The Cq values were not reported for all tests (DATASET 1), of those reported they ranged from 16 to 40, over half were greater than 30 Ct, or the number of cycles the test ran through to get a fluorescent reading.

August 5, 2020 – CEBM: Are you infectious if you have a positive PCR test result for COVID-19? – READ, The Highwire – CREDIT

• At what day of symptom onset did you get the test will influence the probability of a culture positive result.
• SARS-CoV-2 Vero cell infectivity of respiratory samples from SARS-CoV-2 positive individuals was only observed for RT-PCR Ct < 24 and symptom onset to test of < 8 days. 
  • Most accurate (70-80% cance of true positive result) test day is 3 or 4 days post symptom onset
• Infectivity of patients with Ct >24 and duration of symptoms >8 days may be low.

August 4, 2020 – Journal of Clinical Infectious Disease: Predicting Infectious Severe Acute Respiratory Syndrome Coronavirus 2 From Diagnostic Samples – Jefferson et al – READ

July 27, 2020 – The Centre for Evidence-Based Medicine: Predicting infectious SARS-CoV-2 from diagnostic samples- – READ, Bullard et al – READ

Why does the cycle threshold cut-off matter?

• “RT-PCR uses an enzyme called reverse transcriptase to change a specific piece of RNA into a matching piece of DNA. The PCR then amplifies the DNA exponentially, by doubling the number of molecules time and again. A fluorescent signal can be attached to the copies of the DNA, and a test is considered positive when the fluorescent signal is amplified sufficiently to be detectable.
• The cycle threshold (referred to as the Ct value) is the number of amplification cycles required for the fluorescent signal to cross a certain threshold. This allows very small samples of RNA to be amplified and detected.
• The lower the cycle threshold level the greater the amount of RNA (genetic material) in the sample to begin with. The higher the cycle number, the less RNA there is in the sample – the more it needs to be amplified in order to register a flourescent outcome.

• “…inactivated RNA degrades slowly over time it may still be detected many weeks after infectiousness has dissipated.“
• April 27, 2020 – European Journal of Clinical Microbiology & Infectious Diseases: Viral RNA load as determined by cell culture as a management tool for discharge of SARS-CoV-2 patients for infections disease wards -La Scola, Didier Raoult et al – READ, The Highwire – CREDIT

• SARS-CoV-2 RNA positivity in patient samples was assessed by real-time reverse transcription-PCR targeting the E gene.
• We observed a significant relationship between Ct value and culture positivity rate
• No culture was obtained from samples with Ct > 34
• Our results show that in our system of RT-PCR, we can assess that patients with Ct equal or above 34 may be discharged.

July 16, 2020 – This Week in Virology (TWiV) Ep : Guest Dr Anthony Fauci – WATCH, CREDIT, TIMELINE

July 16, 2020 – This Week in Virology (TWiV) episode 641: COVID-19 with Dr. Anthony Fauci – a discussion on SARS-CoV-2 transmission, testing, immunity, pathogenesis, vaccines, and preparedness – WATCH, READ, PCR 35 cycles – EXCERPT, Ron Paul Liberty Report – EXCERPT, The Highwire – WATCH, TIMELINE

[Re PCR] “What is now sort of evolving into a bit of a standard, that if you get a cycle threshold of 35 or more, that the chances of it being replication competent are minuscule…you almost never can culture virus from a 37 threshold cycle…you gotta say it’s just dead nucleotides, period.”

Dr Fauci – EXCERPT

June 4, 2020 – FDA: Coronavirus (COVID-19) Update: FDA Publicly Shares Antibody Test Performance Data From Kits as Part of Validation Study – READ, CREDIT

May 4, 2020 – Aljazeera: Tanzania president questions coronavirus kits after animal test – President Magufuli says tests were found to be faulty after goat, sheep and pawpaw samples test positive for COVID-19. – READ, ARCHIVE, MSN- ARCHIVE

April 19, 2020 – Nature: Antibody tests suggest that coronavirus infections vastly exceed official counts– Study estimates a more than 50-fold increase in coronavirus infections [CASES] compared to official cases [PCR], but experts have raised concerns about the reliability of antibody kits. – READ

• Maybe becasue it was revealing that COVID-19 could have been through the population months earlier – TIMELINE

April 14, 2020 – The Infectious Myth with David Crowe: Interview with Professor Stephen Bustin on Challenges with RT-PCR – LISTEN, DOWNLOAD, ARCHIVE, David Crown [RIP]: Issues with the RT-PCR Coronavirus Test – CREDIT

• “Professor Bustin stated that cycling more than 35 times was unwise, but it appears that nobody is limiting cycles to 35 or less …Cycling too much could result in false positives as background fluorescence builds up in the PCR reaction.” – REF
• “Implicit in using a Ct number is the assumption that approximately the same amount of original RNA (within a multiple of two) will produce the same Ct number. However, there are many possibilities for error in RT-PCR. There are inefficiencies in extracting the RNA, even larger inefficiencies in converting the RNA to complementary DNA (Bustin noted that efficiency is rarely over 50% and can easily vary by a factor of 10), and inefficiencies in the PCR process itself. Bustin, in the podcast, described reliance on an arbitrary Ct number as “absolute nonsense, it makes no sense whatsoever”. It certainly cannot be assumed that the same Ct number on tests done at different laboratories indicates the same original quantity of RNA.” – REF
• “The Ct cycle number will significantly influence the number of positive tests. If the Ct was changed from 37 to 35 there would be fewer positive tests, and if changed to 39 there would more positive tests.” – [Running all tests up to 45 cycles you create a false positive case-demic!]
• PCR can not distinguish between all stages of a case or no case from colonising virus (infected), naturally immune, infected but clearing dead virus/dead nucleotide, recovered from indection past sympomatic or asymptomatic, meaning the “test” canont diagnose and distiguish between active or defective, full virus particles or broken destroyed virus – it is useless as a stand alone test.

March 16, 2020 – FDA: Coronavirus (COVID-19) Update: FDA Provides More Regulatory Relief During Outbreak, Continues to Help Expedite Availability of Diagnostics – ARCHIVE, CREDIT

• “To facilitate early access to serology tests for laboratories and health care providers, the FDA published guidance on March 16 that permitted developers to market their tests without an EUA as long as the test was validated, the FDA was notified, and test reports included important information about limitations, including statements indicating that the test had not been reviewed by the FDA and that results could not be used to diagnose or exclude infection …By the end of April, 164 commercial manufacturers had notified the FDA that they had introduced serology tests.”- REF
  • “In hindsight, however, we realized that the policy outlined in our March 16 guidance was flawed”
• May 4, 2020 – FDA: Insight into FDA’s Revised Policy on Antibody Tests: Prioritizing Access and Accuracy – READ
• Feb 18, 202 – NEJM: The FDA’s Experience with Covid-19 Antibody Tests – READ

March 16, 2020 – WIRED: Everything You Need to Know About Coronavirus Testing- How it works, why we need it, and why it’s taking so damn long for the US to get people diagnosed- ARCHIVE

March 16, 2020 – FDA: Policy for Diagnostic Tests for Coronavirus Disease-2019 during the Public Health Emergency – ARCHIVE

March 16, 2020 – Wired: FDA Approves the First Commercial Coronavirus Tests in the US – Roche RT-PCR tests for COVID-19 and Thermo Fisher for testing instrument – READ

• March 13, 2020 – FDA announcement for ThermoFisher – testing instrument – ARCHIVE, TF – PRESS
• March 16, 2020 – Roche press release – ARCHIVE, not announced by FDA – HERE

March 12, 2020 – AAP News: How to use ICD-10-CM, new lab testing codes for COVID-19 – READ, ARCHIVE

• The Centers for Medicare & Medicaid Services (CMS) developed two new lab testing codes:
  • U0001 will be reported for coronavirus testing using the Centers for Disease Control and Prevention (CDC) 2019 Novel Coronavirus Real Time RT-PCR Diagnostic Test Panel
  • U0002 will be reported for validated non-CDC laboratory tests for SARS-CoV-2/2019-nCoV (COVID-19)
• Acute respiratory distress syndrome (ARDS): ARDS may develop in conjunction with COVID-19. Cases with ARDS due to COVID-19 should be assigned the codes J80, Acute respiratory distress syndrome, and B97.29
  • Do not report “suspected” cases of COVID-19 with B97.29

March 2020 – Luminex SARS-CoV-2 test: Development and Evaluation of Two SARS-CoV-2 RT-PCR Laboratory Developed Tests on the ARIES® Automated, Sample-to-Answer, Real-Time PCR System – Rao et al – PDF,

• This test is “one of the top 4 PCR tests used in the US” – 45 cycles makes it 100% inaccurate if a positive result is returned – The Highwire REF

February 29, 2020 – FDA Update: The FDA encourages development of diagnostic tests for Novel Coronavirus (COVID-19) and we issued an immediately in effect guidance with policy specific to this public health emergency. – ARCHIVE

February 13, 2020 – BBC: Are coronavirus tests flawed? – READ

• “…concerns laboratory tests are incorrectly telling people they are free of the coronavirus!… people are having up to six negative results before finally being diagnosed”. comments from Dr Nathalie MacDermott, of King’s College London
• February 12, 2020 – Radiology: Chest CT for Typical Coronavirus Disease 2019 (COVID-19) Pneumonia: Relationship to Negative RT-PCR Testing – Xie et al –READ
  • Some patients with positive chest CT findings may present with negative results for RT PCR for COVID-19

February 4, 2020 – FDA issued an Emergency Use Authorization (EUA) to authorize the emergency use of Centers for Disease Control and Prevention’s (CDC) 2019-Novel Coronavirus (2019-nCoV) Real-Time Reverse Transcriptase (RT)-PCR Diagnostic Panel – ARCHIVE, the same day US HHS Secretary declared a public health emergency

• for the presumptive qualitative detection of nucleic acid from the 2019-nCoV in upper and lower respiratory specimens (such as nasopharyngeal or oropharyngeal swabs, sputum, lower respiratory tract aspirates, bronchoalveolar lavage, and nasopharyngeal wash/aspirate or nasal aspirate) collected from individuals who meet CDC criteria for 2019-nCoV testing…

• Letter of Authorization – PDF
• Fact Sheet for Healthcare Providers – PDF
• Fact Sheet for Patients – PDF
• Manufacturer Instructions/Package Insert: CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel – PDF

January 24, 2020: WHO Technical Guidance on SARS-CoV-2 Testing – “Novel Coronavirus (2019-nCoV) technical guidance: Laboratory testing for 2019-nCoV in humans” – ARCHIVE

• January 28, 2020 – US CDC: 2019-Novel Coronavirus (2019-nCoV) Real-time rRT-PCR Panel Primers and Probes – ARCHIVE,  PDF1, PDF2
• Jan 21, 2020 – China’s Primer and Probes – ARCHIVE

January 24, 2020 – CDC/NCIRD/DVD: Instructions for Use of Real-Time RT-PCR Panel for Detection 2019-Novel Coronavirus – Centers for Disease Control and Prevention (CDC), Respiratory Viruses Branch, Division of Viral Diseases (DVD) – PDF, source ARCHIVE, TIMELINE

• PCR should be positive at or before 35 cycles of amplification. IMAGE. But amplification indicates up to 45 cycles – IMAGE
• 2019-Novel Coronavirus (2019-nCoV) Real-time rRT-PCR Panel Primers and Probes – PDF
• By February 4, 2020 the PCR threshold was changed to <40 cycles. – PDF, IMAGE

January 23, 2020 – Eurosurveillance: Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR – Corman, Drosten et al – READ

January 21, 2020 – National Institute for Viral Disease Control and Prevention CHINA: Specific primers and probes for detection 2019 novel coronavirus Source: Institute of Viral Diseases – ARCHIVE [Google translate used]

• China Target 1 (ORF1ab):
  • Forward primer (F): CCCTGTGGGTTTTACACTTAA
  • Reverse primer (R): ACGATTGTGCATCAGCTGA
  • Fluorescent probe (P): 5′-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′
• China Target 2 (N):
  • Forward primer (F): GGGGAACTTCTCCTGCTAGAAT
  • Reverse primer (R): CAGACATTTTGCTCTCAAGCTG
  • Fluorescent probe (P): 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3

January 17, 2020 – WHO: Laboratory testing for 2019 novel coronavirus (2019-nCoV) in suspected human cases – Interim guidance – ARCHIVE, PDF, SOURCE

January 17, 2020 – WHO: Diagnostic detection of 2019-nCoV by real-time RT-PCR – Protocol and preliminary evaluation – Drosten et al version 2-1- PDF

January 16, 2020 – European Center for Disease Prevention and Control – Laboratory testing of suspect cases of 2019 nCoV using RT-PCR [page now “Case definition for COVID-19” – HERE] – ARCHIVE, SOURCE

January 16, 2020 – Charite Berlin: Erster Test für das neuartige Coronavirus in China entwickelt [Translateed: First test for the novel coronavirus developed detected in China] – READ, CREDIT, Drosten 2017 interview – READ

• “The working group around Prof. Dr. Christian Drosten, Director of the Institute of Virology at Campus Charité Mitte, developed and made available the world’s first diagnostic test as part of her work at the DZIF. The WHO published the test protocol online as the first guide for laboratories. “
• Addendum of March 23, 2020: publication of the test procedure in the journal Eurosurveillance – ARCHIVE

2018

December 28, 2018 – National Cancer Institute at NIH: Cancer-Causing Substances – Ethylene Oxide – (Last updated Dec 28, 2018) – ARCHIVE, [PCR test swabs are soaked in ethylene oxide to sterilise them], 2015 – ARCHIVE, Dec 5, 2022 update LIVE

• “The primary routes of human exposure to ethylene oxide are inhalation and ingestion, which may occur through occupational, consumer, or environmental exposure.”

April 4, 2018 – Technology Networks: The Future for PCR Diagnostics – READ (Article appears to be a promotion for QuantumDx)

• PCR is becoming the preferred method of diagnosis. For example, the method has been endorsed by the World Health Organization (WHO) for rapid diagnosis of pulmonary tuberculosis (TB)² to replace the standard sputum smear microscopy method developed over a century ago.
• The majority of diagnostics will be based on real-time or quantitative PCR (qPCR). It works by using fluorescently-labeled oligonucleotide probes and monitoring the fluorescence after each cycle – the intensity of the signal reflects the amount of DNA amplified and the number of cycles at which the fluorescence is first detected is used to calculate the initial number of DNA molecules in the sample, once the system has been calibrated.
• amplification of multiple targets in a single PCR experiment by simply using multiple primer pairs…can be useful in diagnosing infectious agents where symptoms are not easily characterized. Up to 20 pathogens can be covered in one test”
• “The potential for PCR diagnostics is huge.” QuantumDx is working on a hand-held PCR device which might one day sit in our home medicine cabinet next to the thermometer
  • 2007 Quantum Dx an early stage diagnostic device manufacturer start-up company – “QuantuMDx has successfully completed a proof of concept exercise, identyfying all three Ashkenazi Jewish BRCA mutations from whole blood” – ARCHIVE part of the Personalised and Precision Medicine movement
  • 2011 – QuantumDx – ARCHIVE
  • 2016 The Future of Diagnostics, hand-held fast diagnostics – ARCHIVE, which integrats diseases diagnosis with the Internet of Things! – ARCHIVE

2017

August 10, 2017 – European J of Clinical Investigation: Talking the talk, but not walking the walk: RT‐qPCR as a paradigm for the lack of reproducibility in molecular research – Stephen Bustin et al – READ, ARCHIVE, David Crowe CREDIT

• “…that the majority of published RT‐qPCR data are likely to represent technical noise”
• April 14, 2020 – Professor Stephen Bustin is a world-renowned expert on quantitative PCR – the Challenges with RT-PCR – LISTEN

2015

April 9, 2015 – Infectious Disease Epidemiology: The History of Pertussis (Whooping Cough); 1906–2015: Facts, Myths, and Misconceptions – Cherry – READ

• “The present “resurgence of pertussis” is mainly due to greater awareness and the use of PCR for diagnosis. There are also many other factors which have contributed to the “resurgence.” New vaccines are clearly needed;…[like mRNA?? because the current “effective” vaccines don’t work?].
• The vaccine stops the cough and allows the infectious agent to spread. “Asymptomatic infections are 4–20 times more common than symptomatic cases”. The vaccinated are a massive sink for spreading B. pertussis!

2008

May 26-27, 2008 – First International Medical Device Regulatory and Compliance Congress held in France – ARCHIVE, ARCHIVE

March 31, 2008- TriMark Publications: Personalized Medicine through Genomic Analysis and Molecular Diagnostics Conference – a critical examination of the molecular diagnostics industry – READ,

• Inspiring a new industry of personalised diagnostic PCR kits and more accessible genetic sequencing such as QuantumDx HERE, HERE, and with use with mobile phone technologies – HERE, CREDIT

2007

October 22, 2007 – TriMark Publications: Point of Care Testing: Innovation on the Move – From Nanotechnology to Personalized Medicine – Conference – READ

January 22, 2007 – Hospital staff at Dartmouth-Hitchcock Medical Center were infomed PCR testing cased a false alarm “pseudo-epidemic” – TIMELINE

2006

March 29-31, 2006 – Harvard holds first annual – Medical Device Regulatory and Compliance Congress – ARCHIVE, ARCHIVE (PCR test is a “medical device”)

• “Benchmarking Your Firm’s Practices in Risk Management, Quality Systems, Fraud and Abuse, and Reimbursement“
• By 2008 – What is FDA’s Focus Today-and its Vision for Tomorrow? – REF

2003

May 22, 2003 – WHO WHA launch the Foundation for Innovative New Diagnostics (FIND) – ARCHIVE

• Because “there is an urgent and unmet need for more accurate and cost-effective diagnostic technologies, particularly for diseases devastating the developing world.”…”Diagnostic tests are also the foundation of disease surveillance and elimination.”
• [So begins the new era of Diagnostics (Dx) – accelerating towards gene-based Personalised Medicine]
• “Diagnosis is the first step on the path to treatment and the foundation of disease control and prevention” – REF
  • [With an approved “diagnosis”, an “evidence-based^TM” treatment “protocol” can then applied, thus eventually eliminating the need for a doctor! Diagnosis assumes one causal agent for all dis-ease]

“There are three phases to treatment: diagnosis, diagnosis and diagnosis

Dr William Osler (1892), the father of modern medicine,

1987

1987 – Methods in Enzymology: Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction – Kary Mullis and Fred Faloon – READ, CREDIT

1984

March 1, 1984 – Journal Clinical Microbiology: Role of recent vaccination in production of false-positive coronavirus antibody titres in cats – Barlough et al – READ Referenced by Dr Buttar (antibody false positive is different to PCR, but important to note.)

The post RT-PCR Tests Used to Determine a “Case” first appeared on Totality of Evidence.

With an “overall decline in disease severity“, and with a “high level of [herd] immunity” globally, in all age groups, as a result of  either infection [natural immunity], vaccine-induced immunity, or hybrid immunity, the guidance is now based on a “simplified” prioriry classification of low, medium and high risk grouping. [1]

Healthy children and adolescents are now “low priority” for COVID-19 vaccination, even though “[p]rimary and booster doses are safe and effective in children and adolescents” – but a high priority for children is their routine vaccinations.

Vaccinating pregnant “persons” to “protects both them and the fetus”, is a priority as “the burden of severe COVID-19 in infants under 6 months is still higher than in children aged 6 months to 5 years” [!!!]

SAGE make no mention of COVID-19 vaccine risks or mounting injuries, particularly in the working age groups and children or pregnancy.

“SAGE also updated their recommendations on bivalent COVID-19 vaccines, now recommending that countries can consider using BA.5 bivalent mRNA vaccine for the primary series”, not just a booster!

The post WHO: vaccine guidance for the “Omicron era” – BA.5 bivalent now considered “primary series” first appeared on Totality of Evidence.