A case of COVID-19 “positive” did not mean the person was sick or infections (or even had the virus!). Before the pandemic, a test was normally performed on someone to confirm a diagnosis that a doctor had drawn form existing symptoms – at diagnostic test normally came AFTER symptoms. During the pandemic PCR testing, with amplifications dialled up over 35 cycles up to 45 cycles, created a “casedemic” of false positive statistically ill persons, which these daily advertised chart used to scare the uninformed populations of the world.

This page will collect links to article, papers and videos piecing together the PCR story, from those who were trying to get the message out about it’s misuse, as well as what public health officials were communicating. It will never be complete but is an attempt to capture and organise this historical information.

• PCR specific data points pulled from the COVID-19 Pandemic timeline – HERE

Some background on Polymerase Chain Reaction (PCR)

Not a “test” but a lab tequnique

In October 2004 the National Institute of Health Genome division defined polymerase chain reaction (PCR) as “A fast, inexpensive technique for making an unlimited number of copies of any piece of DNA. Sometimes called “molecular photocopying”. So not a test, but a lab technique for amplifying genetic material. [1, 2]

PCR redefined as a “diagnostic test”

By 2020 PCR was redefined as a “Diagnostic Test“. A test to diagnosed a disease, including a symptom-less disease (asymptomatic). A “test” that has been adopted globally to diagnose the disease COVID-19, and thus create the “case” statistics.

A test that amplified a small genetic section of a computer “virus” sequence, where the presence of this small segment was said to prove that someone was “diseased”, or “ill” with COVID-19.

The justification for mass testing everyone, stems from the allegedly phenomenon that healthy individuals showing no symptoms (asymptomatic), could be carriers and spread the virus unknowingly (superspreaders) to everyone including the vulnerable members of the population – no matter how little viral load they may or may not have.

If someone has an intact immune system and/or had recently recovered from the viral infection, any trace of RNA in their nasal passage could produce a positive result with PCR, it is that sensitive! Contamination during nasal swab in carparks could also result in a positive result.

As prophylactic treatments and early treatments were taken off the board by authorities, it magnified the health authorities justification for ‘test, test, test’, as they wanted to ensure isolation of asymptomatic individuals, because the vulnerable allegedly had “no protection” until a miracle vaccine could become available.

The goal posts relating to “PCR testing” guidelines (i.e. the cycle threshold (Ct) changed after the COVID-19 vaccines rolled out. The higher the cycles above ~28, were highly likely to return a positive PCR result.

Every time the test is cycled, the genetic material doubles in quantity

PCR is designed as an laboratory tool to amplify quantities of DNA.

Every time the PCR is ran through a “cycle” the primers pick up complimentary genetic material, if present, and then duplicates- “number of DNA molecules can roughly double in each round of cycling.” There are also primers for fluorescent labelling – so when there is enough quantity present the machine can detect the fluorescence.

There needs to be a certain quantity to register as a fluorescence on the machine. If you cycle enough times, eventually you’ll get a ‘positive’ result for an initial genetic fragment – which would be meaningless.

Table 1 shows a doubling effect, starting with the example of just one “fragment” that contains the genetic sequence you are looking for, and how that quantity can potentially expand with each “cycle”.

Look at the quantity for 28 cycles vs 35 vs 45. Dr Fauci said anything greater than 35 cycles is likely dead nucleotide – thus not infectious, it can’t be cultured! He also states the threshold number (Ct) is not provided with the test result unless you ask for it! Knowledge of the number of cycles use to detect a positive result, can help determine the reliability of that positive result

“…with PCR, if you do it well you can find all most anything in anybody“

Kary Mullis circa 1993

CDC initial PCR instructions (35 then 40 cycles)

On January 24, 2020 the CDC put out instructions for use of RT-PCR, for “the in vitro qualitative detection of 2019-Novel Coronavirus (2019-nCoV) in respiratory specimens and sera.”

Under Interpreting Test Results it states “RP should be positive at or before 35 cycles for all clinical samples and HSC, thus indicating the presence of sufficient nucleic acid from human RNase P gene and that the specimen is of acceptable quality.” – PDF. By February 4, 2020 the PCR threshold was changed to <40 cycles. – PDF

November 2020 – The Highwire Ep 188: COVID TESTING FRAUD UNCOVERED – WATCH

Other consequences of the PCR testing procedure

Before we even get to run the test in the lab, the sample has to be collected. There is a whole host of issues here which I’ll also collect links to, for example:

• Why swab deep into the nasal passage when a mouth swab will suffice?
• The synthetic swabs are sterilised with the ethylene oxide – a known carcinogen
• The synthetic fibre from the swab sluff-off in the nasal passage
• Cranial injuries occur – for asymptomatic children and adults
• What about that DNA harvesting? Did you give permission?

Other PCR Resource Sites:

• PCR Claims – HERE
• Corman-Drosten Review – ARCHIVE, HERE
• Swiss Policy Research – The Trouble With PCR Tests – HERE
• Health Canada: Polymerase chain reaction (PCR) and cycle threshold (Ct) values in COVID-19 testing – READ, ARCHIVE

PCR related links in reverse chronological order

This content will be updated as time permits

2024

March 16, 2024- Norman Fenton: Helping understand what ‘false positives’ in diagnostic testing really mean – WATCH, READ

• Many still fail to understand the ‘elephant in the room’ – the impact of the underlying population infection rate.

2023

November 13, 2023 – ICAN: Documents Reveal CDC Was Quietly Giving Advice on How to Handle Breakthrough Infections in March 2021 – READ, TIMELINE

• March 2021 – California’s health department alerted the CDC that it was fielding “many calls” for advice on instances of breakthrough infection. i.e.vaccine failure, yet CDC pushed the vaccine worked!
• In May 2021, CDC was given data showing that over 50% of fully vaccinated assisted living facility residents in a California facility tested positive for COVID-19, some of whom were hospitalized or died within just three months of their second dose. i.e. vaccine failure

September 27, 2023 – Australian Bureau of Statistics: COVID-19 first infectious disease in top 5 causes of death since 1970 – READ [REALLY!! – FOIA the death certificates]

• “COVID-19 was the third leading cause of death in 2022, accounting for more than one in 20 deaths (9,859 of 190,939 deaths), according to figures released today by the Australian Bureau of Statistics (ABS).”
• Senator Rennick: “TGA won’t even release the primer sequences used in PCR testing to prove that other strains aren’t being identified as Covid.” – TWEET
• [why in 2022 and not 2020-21?, when we now know the vaccine increases risk of contracting the virus, see June 12, 2023 – HERE]

September 6, 2023 – Epoch Health: People Rarely Transmit COVID-19 Before Experiencing Symptoms: Lancet Study – READ, ARCHIVE, The Lancet – READ

• A blow to the “silent spreader”, super spreader, asymptomatic narrative – which without highly amplified false positive PCR you’d never “know”
• The Lancet: Viral emissions into the air and environment after SARS-CoV-2 human challenge: a phase 1, open label, first-in-human study – Zhou et al – READ, ARCHIVE
  • “Very few emissions occurred before the first reported symptom (7%) and hardly any before the first positive lateral flow antigen test (2%),”..

August 4, 2023 – Daily Mail: Thousands of Americans potentially exposed to toxic Covid and pregnancy tests made at Chinese-run biolab in California – READ (not PCR but test kits!)

May 18, 2023 – Norman Fenton Substack | Where are the numbers?: The Covid testing swabs debacle – The ritualistic humiliation and pain was all part of the test of compliance and control – READ

March 16, 2023 – Ann R Coll Surg Engl.: COVID-19 nasopharyngeal swab and cribriform fracture by Vasilica et al – READ, CREDIT

• “non-trivial number” of these swab tests were “associated with skull base injury”

February 24, 2023 – FDA News Release: FDA Authorizes First Over-the-Counter At-Home Test to Detect Both Influenza and COVID-19 Viruses – READ [Not PCR, but “diagnostic” test]

January 30, 2023 – Journal of Neurosurgery” Case Lessons: Cerebrospinal fluid fistula as a complication of reverse transcriptase-polymerase chain reaction collection for the detection of coronavirus disease 2019: illustrative cases – Palavani et al – READ, CREDIT

2022

December 18, 2022 – Health.com: Can Anal Swabs Be Used to Test for Coronavirus? – Nose and throat swabs are standard in the U.S – READ – Timeline of the anal swab research

• April 13, 2022, Stanford Medicine STUDY SARS-CoV-2 infected people can shed viral genetic material in their feces for up to 7 months after diagnosis. “The study added to mounting evidence that the SARS-CoV-2 virus actively infects the gut”

2021

November 14, 2021 – The Telegraph: Covid test firm ‘to sell swabs carrying customers’ DNA’ – Cignpost Diagnostics, a government-approved supplier, prompts investigation over sharing of sensitive medical data with third parties – READ, ARCHIVE, CREDIT

October 28, 2021 – Journal of Surgical Case Reports: Cerebrospinal fluid leak post COVID-19 nasopharyngeal swab for a patient with idiopathic intracranial hypertension: a case report – Asiri et al – READ, CREDIT

July 27, 2021 – Reuters: Fact Check-COVID-19 nasal swabs sterilised with ethylene oxide are safe to use – READ, CREDIT

April 5, 2021 – Very Well Health: New COVID-19 Antibody Test ‘Glows’ When Antibodies Are Present – READ [Antibody not virus but putting here]

• The test, called SATiN (which stands for Serological Assay based on split Tripart Nanoluciferase), uses an enzyme called luciferase (the same enzyme that makes fireflies glow). [Intentional acronym?]
• March 22, 2021- Nature: A homogeneous split-luciferase assay for rapid and sensitive detection of anti-SARS CoV-2 antibodies by Yao et al – READ
  • This proof-of-principle study suggests potential applications in diagnostics, as well as disease and vaccination management.

January 27, 2021 – Guardian: China starts using anal swabs to test ‘high-risk’ people for Covid – READ, Reuters – READ, CTV News – READ, Health.com – READ

January 23, 2021 – Peoples Daily | China: Why does nucleic acid testing increase anal swab sampling? Expert Interpretation – (Chinese) READ, CREDIT [Google translator used]

• “Studies have found that the duration of positive nucleic acid in feces or anal swabs of some infected people is longer than that in the upper respiratory tract. Therefore, increasing the nucleic acid detection of anal swabs can increase the detection rate of infected patients and reduce missed diagnoses….At present, anal swab collection is only for key groups.”
• “only throat swabs and anal swabs are collected at the same time for key populations such as isolation points….The purpose of doing so is to increase the detection rate and reduce the probability of false negatives.”
• “In January of 2021, after localized COVID-19 outbreaks in parts of China, including the capital city Beijing, authorities started using anal swabs to test for the virus instead of the usual nose and throat swabs” – REF

2020

December 17, 2020 – Journal of Clinical Infectious Disease: Predicting Infectious Severe Acute Respiratory Syndrome Coronavirus 2 From Diagnostic Samples – Bullard et al – READ, CEBM – READ, CREDIT

• SARS-CoV-2 Vero cell infectivity of respiratory samples from SARS-CoV-2 positive individuals was only observed for RT-PCR Ct < 24 and symptom onset to test of < 8 days. – REF
• Infectivity of patients with Ct >24 and duration of symptoms >8 days may be low.

December 4, 2020 – Medical Journal of Australia: The COVID swab and the skull base – how to stay safe – Mistry et al – READ

• “The mass testing program during COVID-19 has seen vast numbers of nasal and nasopharyngeal swabs performed. We present an extremely rare case of skull base injury and CSF leak with subsequent meningitis, occurring as a complication of a COVID-19 diagnostic swab.” [rare?]

December 2, 2020 – Peak Prosperity w/ Chris Martensen – The lockdowns are based on surging “cases” which are based on positive PCR test results – explanation of PCR Cycle Thresholds (Ct) – WATCH, BACKUP, BACKUP

November 27, 2020 – Corman Drosten Review: Review report Corman-Drosten et al. Eurosurveillance 2020 – ARCHIVE

• External peer review of the RTPCR test to detect SARS-CoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive results. by Borger, Yeadon, Craig, McKernan et al

November 6 , 2020 – Corona Investigative Committee: Sitzung 26: PCR-Test – die Dominosteine fallen (German) – ARCHIVE

November 5, 2020 – The Highwire Ep 188: Lighting the Way – “covid is over” – FULL, COVID TESTING FRAUD UNCOVERED – WATCH

• Del walks through April 27, 2020 paper by Didier Raoult et al – READ, and shows that a PCR test amplified to 33 cycles returns a false positive 80% of the time, so it is only 20% accurated for the potential presence of viable, infectious virus!
• October 31, 2020 – CNN: US coronavirus cases surpass 9 million driven by ‘silent epidemic’ of asymptomatic infections – READ – As Del Bigtree explains – asymptomatic are not carries, nor are they infections as the US labs set their threshold for cycling the tests at 45 Ct – WATCH

November 2020 (?) – Corman Drosten Review: The consequences of false positives – ARCHIVE

October 31, 2020 – CNN: US coronavirus cases surpass 9 million driven by ‘silent epidemic’ of asymptomatic infections – READ – As Del Bigtree explains – asymptomatic are not carries, nor are they infections as the US labs set their threshold for cycling the tests at 45 Ct – WATCH

October 26, 2020 – from The Highwire: TOP DOC CONFIRMS: COVID IS OVER – featuring Dr Mike Yeadon @MichaelYeadon3 statement Twitter – WATCH , Twitter – ARCHIVE, also on The Highwire – WATCH

I think the PCR test at present is throwing up so many false positves that in fact we’re mis-diagnosing the cause of the deaths that are being reported. The number of deaths that are occurring at the moment is normal for the time of year.

Dr Mike Yeadon

September 29, 2020 – The Lancet Respiratory Medicine | Comment: False-positive COVID-19 results: hidden problems and costs by Surkuva et al – READ, CREDIT

September 28, 2020 – Clinical Infectious Disease | Correspondence: Correlation Between 3790 Quantitative Polymerase Chain Reaction–Positives Samples and Positive Cell Cultures, Including 1941 Severe Acute Respiratory Syndrome Coronavirus 2 Isolates by Faafar et al – READ

• “It can be observed that at Ct = 25, up to 70% of patients remain positive in culture and that at Ct = 30 this value drops to 20%. At Ct = 35, the value we used to report a positive result for PCR, <3% of cultures are positive.”

August 29, 2020 – New York Times: Your coronavirus test is positive. Maybe it shouldn’t be. The usual diagnostic test may simply be too sensitive and too slow to contain the spread of the virus – READ, CREDIT

• “Most tests set the limit at 40, a few at 37 [Ct]…The CDC’s own calculations suggests that it is extremely difficult to detect any live virus in a sample above a threshold of 33 cycles.
• Officials at some state labs said the CDC had not asked them to note threshold values or to share them with contact-tracing organizations” [the logical thing that should have been done to help determine accuracy of test results]
• Thermo Fisher COVID-19 tests “automatically classifies results based on a cut-off of 37 cycles…testers did not have access to the precice numbers”
• “In Massachusetts, from 85 to 90 percent of people who tested positive in July with a cycle threshold of 40 would have been deemed negative if the threshold were 30 cycles, Dr. Mina said. “I would say that none of those people should be contact-traced, not one,”’
• “85 to 90 % of people who tested positive in July 2020 with a cycle threshold of 40 would have been deemed negative if the threshold were 30 cycles, Dr. Mina said. “I would say that none of those people should be contact-traced, not one,”

August 18, 2020 – PNAS: Haplotype networks of SARS-CoV-2 infections in the Diamond Princess cruise ship outbreak by Sekizuka et al – READ, PANDA – CREDIT

• The examination of 900 swab samples taken onboard the Diamond Princess passengers and crew February 15 to 17, 2020 “indicates no correlation between Ct value of positive tests, symptomatic vs asymptomatic, or even symptoms vs positive tests. Clearly this sheds some doubt on whether those specimens considered positive really were of live infections, and whether those with symptoms (but testing negative) were actually suffering from Covid-19. In a documentary with footage largely sourced from passenger and crew cell phones, not a single person appeared ill, including some passengers evacuated to hospitals.” PANDA – REF
• 43 people had COVID-19 symptoms, but tested negative, 125 had no symptoms but tested positive!
• The Cq values were not reported for all tests (DATASET 1), of those reported they ranged from 16 to 40, over half were greater than 30 Ct, or the number of cycles the test ran through to get a fluorescent reading.

August 5, 2020 – CEBM: Are you infectious if you have a positive PCR test result for COVID-19? – READ, The Highwire – CREDIT

• At what day of symptom onset did you get the test will influence the probability of a culture positive result.
• SARS-CoV-2 Vero cell infectivity of respiratory samples from SARS-CoV-2 positive individuals was only observed for RT-PCR Ct < 24 and symptom onset to test of < 8 days. 
  • Most accurate (70-80% cance of true positive result) test day is 3 or 4 days post symptom onset
• Infectivity of patients with Ct >24 and duration of symptoms >8 days may be low.

August 4, 2020 – Journal of Clinical Infectious Disease: Predicting Infectious Severe Acute Respiratory Syndrome Coronavirus 2 From Diagnostic Samples – Jefferson et al – READ

July 27, 2020 – The Centre for Evidence-Based Medicine: Predicting infectious SARS-CoV-2 from diagnostic samples- – READ, Bullard et al – READ

Why does the cycle threshold cut-off matter?

• “RT-PCR uses an enzyme called reverse transcriptase to change a specific piece of RNA into a matching piece of DNA. The PCR then amplifies the DNA exponentially, by doubling the number of molecules time and again. A fluorescent signal can be attached to the copies of the DNA, and a test is considered positive when the fluorescent signal is amplified sufficiently to be detectable.
• The cycle threshold (referred to as the Ct value) is the number of amplification cycles required for the fluorescent signal to cross a certain threshold. This allows very small samples of RNA to be amplified and detected.
• The lower the cycle threshold level the greater the amount of RNA (genetic material) in the sample to begin with. The higher the cycle number, the less RNA there is in the sample – the more it needs to be amplified in order to register a flourescent outcome.

• “…inactivated RNA degrades slowly over time it may still be detected many weeks after infectiousness has dissipated.“
• April 27, 2020 – European Journal of Clinical Microbiology & Infectious Diseases: Viral RNA load as determined by cell culture as a management tool for discharge of SARS-CoV-2 patients for infections disease wards -La Scola, Didier Raoult et al – READ, The Highwire – CREDIT

• SARS-CoV-2 RNA positivity in patient samples was assessed by real-time reverse transcription-PCR targeting the E gene.
• We observed a significant relationship between Ct value and culture positivity rate
• No culture was obtained from samples with Ct > 34
• Our results show that in our system of RT-PCR, we can assess that patients with Ct equal or above 34 may be discharged.

July 16, 2020 – This Week in Virology (TWiV) Ep : Guest Dr Anthony Fauci – WATCH, CREDIT, TIMELINE

July 16, 2020 – This Week in Virology (TWiV) episode 641: COVID-19 with Dr. Anthony Fauci – a discussion on SARS-CoV-2 transmission, testing, immunity, pathogenesis, vaccines, and preparedness – WATCH, READ, PCR 35 cycles – EXCERPT, Ron Paul Liberty Report – EXCERPT, The Highwire – WATCH, TIMELINE

[Re PCR] “What is now sort of evolving into a bit of a standard, that if you get a cycle threshold of 35 or more, that the chances of it being replication competent are minuscule…you almost never can culture virus from a 37 threshold cycle…you gotta say it’s just dead nucleotides, period.”

Dr Fauci – EXCERPT

June 4, 2020 – FDA: Coronavirus (COVID-19) Update: FDA Publicly Shares Antibody Test Performance Data From Kits as Part of Validation Study – READ, CREDIT

May 4, 2020 – Aljazeera: Tanzania president questions coronavirus kits after animal test – President Magufuli says tests were found to be faulty after goat, sheep and pawpaw samples test positive for COVID-19. – READ, ARCHIVE, MSN- ARCHIVE

Nature: April 19, 2020 – Nature: Antibody tests suggest that coronavirus infections vastly exceed official counts– Study estimates a more than 50-fold increase in coronavirus infections [CASES] compared to official cases [PCR], but experts have raised concerns about the reliability of antibody kits. – READ

• Maybe becasue it was revealing that COVID-19 could have been through the population months earlier – TIMELINE

March 16, 2020 – FDA: Coronavirus (COVID-19) Update: FDA Provides More Regulatory Relief During Outbreak, Continues to Help Expedite Availability of Diagnostics – ARCHIVE, CREDIT

• “To facilitate early access to serology tests for laboratories and health care providers, the FDA published guidance on March 16 that permitted developers to market their tests without an EUA as long as the test was validated, the FDA was notified, and test reports included important information about limitations, including statements indicating that the test had not been reviewed by the FDA and that results could not be used to diagnose or exclude infection …By the end of April, 164 commercial manufacturers had notified the FDA that they had introduced serology tests.”- REF
  • “In hindsight, however, we realized that the policy outlined in our March 16 guidance was flawed”
• May 4, 2020 – FDA: Insight into FDA’s Revised Policy on Antibody Tests: Prioritizing Access and Accuracy – READ
• Feb 18, 202 – NEJM: The FDA’s Experience with Covid-19 Antibody Tests – READ

March 16, 2020 – WIRED: Everything You Need to Know About Coronavirus Testing- How it works, why we need it, and why it’s taking so damn long for the US to get people diagnosed- ARCHIVE

March 16, 2020 – FDA: Policy for Diagnostic Tests for Coronavirus Disease-2019 during the Public Health Emergency – ARCHIVE

March 16, 2020 – Wired: FDA Approves the First Commercial Coronavirus Tests in the US – Roche RT-PCR tests for COVID-19 and Thermo Fisher for testing instrument – READ

• March 13, 2020 – FDA announcement for ThermoFisher – testing instrument – ARCHIVE, TF – PRESS
• March 16, 2020 – Roche press release – ARCHIVE, not announced by FDA – HERE

March 12, 2020 – AAP News: How to use ICD-10-CM, new lab testing codes for COVID-19 – READ, ARCHIVE

• The Centers for Medicare & Medicaid Services (CMS) developed two new lab testing codes:
  • U0001 will be reported for coronavirus testing using the Centers for Disease Control and Prevention (CDC) 2019 Novel Coronavirus Real Time RT-PCR Diagnostic Test Panel
  • U0002 will be reported for validated non-CDC laboratory tests for SARS-CoV-2/2019-nCoV (COVID-19)
• Acute respiratory distress syndrome (ARDS): ARDS may develop in conjunction with COVID-19. Cases with ARDS due to COVID-19 should be assigned the codes J80, Acute respiratory distress syndrome, and B97.29
  • Do not report “suspected” cases of COVID-19 with B97.29

March 2020 – Luminex SARS-CoV-2 test: Development and Evaluation of Two SARS-CoV-2 RT-PCR Laboratory Developed Tests on the ARIES® Automated, Sample-to-Answer, Real-Time PCR System – Rao et al – PDF,

• This test is “one of the top 4 PCR tests used in the US” – 45 cycles makes it 100% inaccurate if a positive result is returned – The Highwire REF

February 13, 2020 – BBC: Are coronavirus tests flawed? – READ

• “…concerns laboratory tests are incorrectly telling people they are free of the coronavirus!… people are having up to six negative results before finally being diagnosed”. comments from Dr Nathalie MacDermott, of King’s College London
• February 12, 2020 – Radiology: Chest CT for Typical Coronavirus Disease 2019 (COVID-19) Pneumonia: Relationship to Negative RT-PCR Testing – Xie et al –READ
  • Some patients with positive chest CT findings may present with negative results for RT PCR for COVID-19

January 24, 2020: WHO Technical Guidance on SARS-CoV-2 Testing – “Novel Coronavirus (2019-nCoV) technical guidance: Laboratory testing for 2019-nCoV in humans” – ARCHIVE

• January 28, 2020 – US CDC: 2019-Novel Coronavirus (2019-nCoV) Real-time rRT-PCR Panel Primers and Probes – ARCHIVE,  PDF1, PDF2
• Jan 21, 2020 – China’s Primer and Probes – ARCHIVE

January 24, 2020 – CDC/NCIRD/DVD: Instructions for Use of Real-Time RT-PCR Panel for Detection 2019-Novel Coronavirus – Centers for Disease Control and Prevention (CDC), Respiratory Viruses Branch, Division of Viral Diseases (DVD) – PDF, source ARCHIVE, TIMELINE

• PCR should be positive at or before 35 cycles of amplification. IMAGE. But amplification indicates up to 45 cycles – IMAGE
• 2019-Novel Coronavirus (2019-nCoV) Real-time rRT-PCR Panel Primers and Probes – PDF
• By February 4, 2020 the PCR threshold was changed to <40 cycles. – PDF, IMAGE

January 23, 2020 – Eurosurveillance: Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR – Corman, Drosten et al – READ

January 21, 2020 – National Institute for Viral Disease Control and Prevention CHINA: Specific primers and probes for detection 2019 novel coronavirus Source: Institute of Viral Diseases – ARCHIVE [Google translate used]

• China Target 1 (ORF1ab):
  • Forward primer (F): CCCTGTGGGTTTTACACTTAA
  • Reverse primer (R): ACGATTGTGCATCAGCTGA
  • Fluorescent probe (P): 5′-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′
• China Target 2 (N):
  • Forward primer (F): GGGGAACTTCTCCTGCTAGAAT
  • Reverse primer (R): CAGACATTTTGCTCTCAAGCTG
  • Fluorescent probe (P): 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3

January 17, 2020 – WHO: Laboratory testing for 2019 novel coronavirus (2019-nCoV) in suspected human cases – Interim guidance – ARCHIVE, PDF, SOURCE

January 17, 2020 – WHO: Diagnostic detection of 2019-nCoV by real-time RT-PCR – Protocol and preliminary evaluation – Drosten et al version 2-1- PDF

January 16, 2020 – European Center for Disease Prevention and Control – Laboratory testing of suspect cases of 2019 nCoV using RT-PCR [page now “Case definition for COVID-19” – HERE] – ARCHIVE, SOURCE

January 16, 2020 – Charite Berlin: Erster Test für das neuartige Coronavirus in China entwickelt [Translateed: First test for the novel coronavirus developed detected in China] – READ, CREDIT, Drosten 2017 interview – READ

• “The working group around Prof. Dr. Christian Drosten, Director of the Institute of Virology at Campus Charité Mitte, developed and made available the world’s first diagnostic test as part of her work at the DZIF. The WHO published the test protocol online as the first guide for laboratories. “
• Addendum of March 23, 2020: publication of the test procedure in the journal Eurosurveillance – ARCHIVE

2018

December 28, 2018 – National Cancer Institute at NIH: Cancer-Causing Substances – Ethylene Oxide – (Last updated Dec 28, 2018) – ARCHIVE, [PCR test swabs are soaked in ethylene oxide to sterilise them], 2015 – ARCHIVE, Dec 5, 2022 update LIVE

• “The primary routes of human exposure to ethylene oxide are inhalation and ingestion, which may occur through occupational, consumer, or environmental exposure.”

April 4, 2018 – Technology Networks: The Future for PCR Diagnostics – READ (Article appears to be a promotion for QuantumDx)

• PCR is becoming the preferred method of diagnosis. For example, the method has been endorsed by the World Health Organization (WHO) for rapid diagnosis of pulmonary tuberculosis (TB)² to replace the standard sputum smear microscopy method developed over a century ago.
• The majority of diagnostics will be based on real-time or quantitative PCR (qPCR). It works by using fluorescently-labeled oligonucleotide probes and monitoring the fluorescence after each cycle – the intensity of the signal reflects the amount of DNA amplified and the number of cycles at which the fluorescence is first detected is used to calculate the initial number of DNA molecules in the sample, once the system has been calibrated.
• amplification of multiple targets in a single PCR experiment by simply using multiple primer pairs…can be useful in diagnosing infectious agents where symptoms are not easily characterized. Up to 20 pathogens can be covered in one test”
• “The potential for PCR diagnostics is huge.” QuantumDx is working on a hand-held PCR device which might one day sit in our home medicine cabinet next to the thermometer
  • 2007 Quantum Dx an early stage diagnostic device manufacturer start-up company – “QuantuMDx has successfully completed a proof of concept exercise, identyfying all three Ashkenazi Jewish BRCA mutations from whole blood” – ARCHIVE part of the Personalised and Precision Medicine movement
  • 2011 – QuantumDx – ARCHIVE
  • 2016 The Future of Diagnostics, hand-held fast diagnostics – ARCHIVE, which integrats diseases diagnosis with the Internet of Things! – ARCHIVE

2015

April 9, 2015 – Infectious Disease Epidemiology: The History of Pertussis (Whooping Cough); 1906–2015: Facts, Myths, and Misconceptions – Cherry – READ

• “The present “resurgence of pertussis” is mainly due to greater awareness and the use of PCR for diagnosis. There are also many other factors which have contributed to the “resurgence.” New vaccines are clearly needed;…[like mRNA?? because the current “effective” vaccines don’t work?].
• The vaccine stops the cough and allows the infectious agent to spread. “Asymptomatic infections are 4–20 times more common than symptomatic cases”. The vaccinated are a massive sink for spreading B. pertussis!

2008

May 26-27, 2008 – First International Medical Device Regulatory and Compliance Congress held in France – ARCHIVE, ARCHIVE

March 31, 2008- TriMark Publications: Personalized Medicine through Genomic Analysis and Molecular Diagnostics Conference – a critical examination of the molecular diagnostics industry – READ,

• Inspiring a new industry of personalised diagnostic PCR kits and more accessible genetic sequencing such as QuantumDx HERE, HERE, and with use with mobile phone technologies – HERE, CREDIT

2007

October 22, 2007 – TriMark Publications: Point of Care Testing: Innovation on the Move – From Nanotechnology to Personalized Medicine – Conference – READ

January 22, 2007 – Hospital staff at Dartmouth-Hitchcock Medical Center were infomed PCR testing cased a false alarm “pseudo-epidemic” – TIMELINE

2006

March 29-31, 2006 – Harvard holds first annual – Medical Device Regulatory and Compliance Congress – ARCHIVE, ARCHIVE (PCR test is a “medical device”)

• “Benchmarking Your Firm’s Practices in Risk Management, Quality Systems, Fraud and Abuse, and Reimbursement“
• By 2008 – What is FDA’s Focus Today-and its Vision for Tomorrow? – REF

2003

May 22, 2003 – WHO WHA launch the Foundation for Innovative New Diagnostics (FIND) – ARCHIVE

• Because “there is an urgent and unmet need for more accurate and cost-effective diagnostic technologies, particularly for diseases devastating the developing world.”…”Diagnostic tests are also the foundation of disease surveillance and elimination.”
• [So begins the new era of Diagnostics (Dx) – accelerating towards gene-based Personalised Medicine]
• “Diagnosis is the first step on the path to treatment and the foundation of disease control and prevention” – REF
  • [With an approved “diagnosis”, an “evidence-based^TM” treatment “protocol” can then applied, thus eventually eliminating the need for a doctor! Diagnosis assumes one causal agent for all dis-ease]

“There are three phases to treatment: diagnosis, diagnosis and diagnosis

Dr William Osler (1892), the father of modern medicine,

1987

1987 – Methods in Enzymology: Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction – Kary Mullis and Fred Faloon – READ, CREDIT

1984

March 1, 1984 – Journal Clinical Microbiology: Role of recent vaccination in production of false-positive coronavirus antibody titers in cats – Barlough etal – READ Referenced by Dr Buttar (antibody false positive is different to PCR, but important to note.)

The post RT-PCR Tests Used to Determine a “Case” first appeared on Totality of Evidence.

“This is the greatest hoax ever perpetrated on an unsuspecting public.”

Dr Roger Hodkinson, November 2020

His comments back then in 2020 about the virus, testing, masks, social distancing have proven correct – because they were based on scientific knowledge and statistical data.

On that phone call Dr Hodkinson shared his credentials to assure the audience he is “not a quack” and that he was well qualified and in a unique position to make the claims that he did.

Dr Hodkinson is a Cambridge University trained Medical Doctor who is a board certified pathologist in both the USA and Canada. He emigrating to Canada in 1970. His career has spanned general medical practice, community hospitals, academia and entrepreneurial business. He was an Assistant Professor in the faculty of Medicine at University of Alberta, the former chairman of the examination committee for general pathology at the Royal Collage of Physicians & Surgeons in Ottawa and was/is[?] the CEO & Medical Director of Western Medical Assessments in Edmonton, Canada.

For many years he has been a public health advocate. He was the Honorary Chairman of Action on Smoking and Health (ASH), a non-profit organization in Canada “tackling the predatory marketing strategies of Big Tobacco”, and for which he was made Citizen of the Year in Edmonton, Alberta (1994?). [REF]

He is currently Executive Chairman of MutantDx, a “Liquid Biopsy Company” in North Carolina, involved in molecular diagnostics for early cancer detection. He stated in November 2020 that he was involved in “selling COVID-19 tests” [unclear for which company he is referring to] which together with his past experience meant he is very qualified to comment on the public health response to COVID-19.

Throughout the pandemic Dr Hodkinson, like many other experts, has been passionately speaking out against the unscientific, draconian measures in Canada and the world. He has followed the evidence as he was trained to do, and teachers other to do, for that he has been attacked by the media and health “authorities”.

Below is a collection of his speeches, interviews and articles relating to Dr Roger Hodkinson.

Links in reverse chronological order

2024

January 24, 2024 – Dr Trozzi’s Substack: Dr Roger Hodkinson and Dr Mark Trozzi – No Holds Barred Podcast
Medicine, science, politics, crimes, corruption, and bold solutions (with resource links) – READ & WATCH, EXCERPT

2022

November 26, 2022 – Dr. Roger Hodkinson speaks at Rebel News LIVE! 2022 in Calgary, Alberta – EXCERPT, full speech subscriber only, READ

I’ve got 30 minutes with you and I intend to use every single second to scare the shit out of you!

I know I’m talking to the choir, but I want to leave you with sound-bites to use with others. Because [you have to] spread the message individually.…

What’s happened over the past 3 years has been the biggest, avoidable catastrophe in human history – PERIOD!

...we’ve been prisoners in our own countries for 3 years

November 8, 2022 – Just Right Media with Robert Vaughan: First, do no harm | Dr. Roger Hodkinson – WATCH

October 5, 2022 – Laura-Lynn Tyler Thompson: Live with Dr. Roger Hodkinson; Fertility, Cancer, Flight Safety and SADS – WATCH, BACKUP, Vigilant Fox – CREDIT

• References: August 20, 2022 – Peter Halligan Substack: 20 million saved or 20 million killed – truth is treason in the empire of lies – READ, Expose News – READ

Global deaths directly attributable to the vaccine 20 million, two-zero million deaths due to the clot shot. And 2 Billion, big B…serious adverse reactions

Dr Hodkinson

August 25, 2022 – Laura-Lynn Tyler Thompson : Why Is No One Talking About Sudden Dead Doctor Syndrome? – Dr Hodkinson discusses silence over the epidemic of Canadian doctors who are suddenly dropping dead – WATCH, BACKUP

August 7, 2022 – Bright Light News: [INTERVIEW] Why Are Canadian Doctors Dying in Unprecedented Numbers? Dr. Roger Hodkinson Interview – WATCH, READ

June 27, 2022 – Rebel News: Could gain-of-function research wipe out humanity? Chairmen of a Liquid Biopsy company working with DNA sequencing believes so – WATCH, READ, EXCERPT

• “Far More Serious Than Nuclear War” – We Must Put an End to Gain-of-Function Research – EXCERPT

June 22, 2022 – Rebel News: The government is your doctor now — leading pathologist speaks out – WATCH, READ

May 20, 2022 – Laura-Lynn Tyler Thompson: Vaccine Injuries With Dr. Daniel Nagase – with Roy Beyer and Dr. Roger Hodkinson to discuss Jason Kenney’s resignation, The Great Reset, and the continuous assault on Canadian freedoms – WATCH, FULL

February 15, 2022 – Dr Roger Hodgkinson, Canadian doctor, accuses covid co-conspirators of murder – WATCH, BACKUP

February 14, 2022? -Dr. Roger Hodkinson: “It’s all been a pack of lies” – WATCH, SOURCE

February 11, 2022 – Live Streamed by Laura-Lynn: Ottawa debate – Dr Roger Hodkinson, Dr. Paul Alexander and Dr, Byram Bridle – WATCH, BACKUP, Presentations Hodkinson – WATCH, Alexander – WATCH, Bridle – WATCH

• Members of Public Health Officers of Canada Dr. Theresa Tam, Dr Howard Njoo and Dr. Shelly Deeks did not show up for the debate.

2021

December 17, 2021 – Asia Pacific Today: Vaccines: Sacrificing the Children to Save the Vulnerable w/ Dr. Roger Hodkinson is the CEO and Medical Director of MedMalDoctors – WATCH, READ

• Dr. Hodkinson has pleaded to stop the madness of COVID19 fraud and the vaccines’ served up to fight the pandemic. He has called out deception, Big Pharma, corrupt political leaders and a compliant mainstream media.

October 17, 2021 – Okotoks Alberta Freedom Rally: Another powerful speech by Dr. Roger Hodkinson – WATCH, BACKUP

July 24, 2021 – Canadian Protest – “Stop the Shots”: another powerful speech – WATCH, BACKUP

“I’m putting my career on the line here”

July 5, 2021 – Agora Media | Toronto Business Journal: Dr. Roger Hodkinson Discusses Fear and the Pandemic – PART 1, PART 2, PART 3

July 4, 2021 – Agora Media | Toronto Business Journal: EXPOSED – The Persecution of Canadian Physicians by Organized Medicine During the COVID-19 Pandemic – WATCH, READ, EXCERPT, YouTube, BACKUP

• “In this group interview facilitated by Sam Dubé, M.D., Ph.D., four physicians from across Canada – emergency physician Dr. Chris Milburn, rural family physician Dr. Charles Hoffe, general surgeon Dr. Francis Christian, and pathologist Dr. Roger Hodkinson – tell their stories of persecution at the hands of their governing bodies. Their only crime: practicing evidence-based medicine by questioning the safety of their patients and the public during the pandemic.”

June 30, 2021 – Agora Media | Toronto Business Journal: Dr. Roger Hodkinson Follow-up Interview – Breaking News – WATCH

• “Just 36 hours after his original in-depth 2-hour interview with Dr. Sam Dubé, [dated July 5, 2021 above?] renowned pathologist Dr. Roger Hodkinson follows up with three hot news items (one technically a “timely” re-release) regarding the pandemic.”

June 22, 2021 – The Highwire Ep 220 | DIRTY DEEDS: We’re playing with Fire Here – from tyrannical lockdowns to his fears of the long term catastrophic damage from the vaccine, especially in young people – WATCH, EXCERPT, FULL, BACKUP

June 11, 2021 – German Corona Investigative Committee (Stiftung Corona Ausschuss) Session 56 – Featuring Dr Hodkinson @ 2:52:59 – WATCH, FULL, ARCHIVE, BACKUP, Odysee – BACKUP

June 11, 2021 – Anna Brees Media: Dr Roger Hodkinson – third interview with an urgent message – WATCH

June 10, 2021 – PROTEST: Art Lucier introduces Dr. Roger Hodkinson at the Edmonton Legislature grounds – WATCH, BACKUP

July 5, 2021 – [Source unclear]: EXPOSED – The Persecution of Canadian Physicians by Organized Medicine During the COVID-19 Pandemic – a discussion facilitated by Sam Dubé, M.D., Ph.D., the physicians tell their stories of persecution at the hands of their governing bodies – WATCH, BACKUP, Odysee – BACKUP

• emergency physician Dr. Chris Milburn,
• rural family physician Dr. Charles Hoffe,
• general surgeon Dr. Francis Christian,
• pathologist Dr. Roger Hodkinson

May 23, 2021 – Expose News: An exclusive interview with Dr Roger Hodkinson – “When the history of this madness is written, reputations will be slaughtered and there will be blood in the gutter “ – READ, Natural News – READ

• “Dr Roger Hodkinson says there is “sufficient evidence in the literature” to show the spike protein expresses in the placenta and the testes – and could kill unborn babies in current pregnancies and permanently stop men having children.”

“Our immune system is so unbelievably efficient and these variants, only the nucleic acid sequence varies only about 3% from the original version, so the reality is that the rest of the virus is going to be attacked by the immune system whether it’s a variant or not”

Dr Hodkinson

May 13, 2021 – American Institute of Economic Research: Canadian Doctors Are Being Censored [relevant] – READ

Includes quotes and statements by:

• The College of Physicians and Surgeons of Ontario (CPSO), and
• push back with the “Declaration of Canadian Physicians for Science & Truth – READ

May 5, 2021 – Whats Up Canada? | Doctor Talks Part 9: The Canadian State of Medicine with Dr Roger Hodkinson – WATCH, FULL

April 11, 2021 – Alberta’s Medical Experts Speak! Dr. Hodkinson and Dr. Dennis Modry – WATCH, BACKUP, CREDIT

• “On Monday, March 29, 2021 Alberta’s Multidisciplinary Team of David Redman, Dr. Roger Hodkinson, Dr. Dennis Modry and David Dickson extended an invitation to Premier Kenney, the COVID-19 response team, including Chief Medical Officer of Health Dr. Deena Hinshaw, and Minister of Health Tyler Shandro, to participate in a public forum, an academic debate, to discuss the Alberta Government’s response to the pandemic”

April 10, 2021 – Anna Brees Media: Interview with Dr Hodkinson – TWEET

2020

December 15, 2020 – CHD | The Defender: Leading Canadian Health Expert Outraged at Government Response to COVID – READ

December 3, 2020 – Randy Hillier speaks with Dr Roger Hodkinson – WATCH

December 3, 2020 – Associate Press “fact checker” : Pathologist falsely claims COVID-19 is a hoax, no worse than the flu – READ

• This fact checker didn’t check the facts….Hodkinson never claimed to be chairman of the Royal College of Physicians and Surgeons of Canada, he said he was “chairman of the examination committee for general pathology” at the said college – there’s a difference, and AP got it wrong. Royal College – STATEMENT

November 27, 2020 – Anna Brees Media: Dr. Hodkinson responds to his 5-minute viral video that went viral – On Being Censored and Receiving Death Threats for Claiming Coronavirus “Greatest Hoax” – WATCH, ARCHIVE, ORIGINAL, CREDIT, Anna Brees channel was deleted from Vimeo – HERE

November 17, 2020 – Western Standard News: Senior doc says Alberta politicians ‘playing medicine.’ media driving ‘hysteria’ – READ

November 13, 2020 – Council Chambers – City of Edmonton: Community and Public Services Committee – Dr Roger Hodkinson 5 minute phone speech the Canadian city council chamber members – which went viral – LISTEN, EXCERPT, BACKUP, YouTube (deleted) – ARCHIVE, BACKUP,Text file – TRANSCRIPT, Web – TRANSCRIPT, City of Edmonton meeting – HERE

The bottom line is simply this, there is utterly unfounded public hysteria driven by the media and politicians, it’s outrageous. This is the greatest hoax ever perpetrated on an unsuspecting public.…

There is absolutely nothing that can be done to contain this virus, other than protecting your more vulnerable people. It should be though as nothing more than a bad flu season.…

Masks are utterly useless. There is no evidence base for their effectiveness what so ever….

Social distancing is also useless because COVID is spread by aerosols which travels 30 metres or so before landing…Everywhere should be open tomorrow, as was stated in The Great Barrington Declaration…

And a word on testing. I do what to emphasise I’m in the business of testing for COVID. I do what to emphasise that positive test results do not, underlined in neon, mean a clinical infection. It’s simply driving public hysteria, and all testing should stop, unless you’re presenting to hospital with some respiratory problem.

All that should be done is to protect the vulnerable, and to give them all in the nursing homes…three to five thousand international units of vitamin D every day, which has been shown to radically reduce the likelihood of infection.

…the risk of death under 65 in this province is 1 in 300,000….ITS JUST ANOTHER BAD FLU and you’ve gotta get your minds around that. Let people make their own decisions….

You should be totally out of the business of medicine. You’ve been led down the garden path the chief medical officer of health of this province. I’m absolutely outraged that this has reached this level. It should all stop tomorrow.

Thank you very much.

Excerpts from Dr Hodkinson’s leaked phone call

2017

December 29, 2017 – MNN Mutant News Network: Dr. Roger Hodkinson on MutantDx Liquid Biopsy – WATCH, other videos – HERE

2015

November 17, 2015 – National Post: New firm offers ‘malpractice check’ to investigate if patients died from to preventable mistakes – Dr Hodkinson is CEO of Malpractice Check – READ

The post Dr Roger Hodkinson first appeared on Totality of Evidence.

For all articles and links relating to RT-PCR Tests used to “Diagnose” COVID-19 go HERE

PCR evidence you will discover in the timeline:

• Increased PCR Testing was the main metric to justify lockdowns.
• Increases in case statistics did not correlate with hospital admissions.
• The PCR tests were never intended to be used on ‘well’ people with no clinical symptoms.
• Cycles of amplification (Ct) >24 shows no viable SARS-CoV-2 virus

PCR specific data points from the Pandemic Timeline

2007

January 22 2007

PCR test causes pseudo-epidemic chaos

By 2007 the PCR test is increasing in usage to diagnose disease and is instrumental in escalating the incidence of pseudo-epidemics.  In 2006 the PCR test was relied upon for its speed and highly sensitive nature, and led epidemiologists and infectious disease specialists to use it’s positive result to diagnose what initially was suspected whooping cough epidemic.   [1] The 2006 coughing spree at the Dartmouth-Hitchcock Medical Center caused officials to PCR test all staff, furloughing and quarantining them until their PCR test was returned.  When results came in 142 people tested positive for Whooping Cough, and thousands were “treated” with antibiotics and vaccines.  The hospital ICU was closed. Eight months later, by January 22, 2007, the hospital staff were informed it was a false alarm. [2] “Not a single case of whooping cough was confirmed with the definitive test, growing the bacterium, Bordetella pertussis, in the laboratory.”

“It’s a problem; we know it’s a problem,” … “My guess is that what happened at Dartmouth is going to become more common.” said Dr. Perl

The tests’ “very sensitivity makes false positives likely, and when hundreds or thousands of people are [mass] tested, as occurred at Dartmouth, false positives can make it seem like there is an epidemic.”  

2008

May 19 2008

WHO launches GISAID online database

On May 19, 2008, the WHO Global Initiative on Sharing All Influenza Data (GISAID) was launched at the 61st WHA as a public online database for influenza data, on the back of Indonesia’s 2007 bird flu and the mainstream media’s attention. [1, 2, 3]  The initial funding to “kickstart the development of GISAID’s EpiFlu database application” was provided by US HHS.

On April 15, 2010 a public-private partnership was made with the German government where they became the “official host of the GISAID platform and EpiFlu database”.  The goal is to have “free worldwide exchange of genetic and epidemiological data on known and newly discovered influenza viruses”.

Melbourne’s Doherty Institute has members on the GISAID governance bodies.

Around April 2020 Coronaviruses began being surveilled by the newly established GISAID EpiCoV platform, which CSIRO uses to track COVID-19 genomes. [4]

The CSL company Seqirus a vaccine manufacture and a “leading innovator in influenza vaccine technologies and pandemic response solutions, is [also] a contributor to the GISAID public-private partnership.”

2019

August 7 2019

Kary Mullis, the inventor of PCR, passes away

Kary Banks Mullis, who received the Nobel Prize in Chemistry in 1993 for his invention of PCR, died on August 7, 2019 of pneumonia at the age of 74. [1, 2, 3]

Kary was clear that PCR tests are not a diagnostic tool, they can’t tell you that you’re sick. [5]

“PCR is just a process that is used to make a whole lot of something out of something” because there’s “very few molecules that you don’t have at least one single one of in your body.”

The intended use of the PCR was, and still is, to apply it as a manufacturing technique, being able to replicate DNA sequences millions and billions of times, and not as a diagnostic tool to detect viruses.[4]

Mullis once stated that Dr Anthony Fauci “doesn’t know anything about anything” and because of this “he should not be in the position he’s in”.

More on PCR >>

2020

January 10 2020

Novel coronavirus (2019-nCoV) genome sequence is made public

The sequence of the novel coronavirus (SARS-CoV-2) was posted to a public web server on January 10, 2020 [6]

Following China’s Jan 7, 2020 announcement a “viral genome sequence was released for immediate public health support via the community online resource virological.org on 10 January (Wuhan-Hu-1, GenBank accession number MN908947), followed by four other genomes deposited on 12 January in the viral sequence database curated by the Global Initiative on Sharing All Influenza Data (GISAID)”, according to Drosten et al. [4]

According to WHO  on 12 January 2020, “China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

The genetic sequence of 2019–nCoV (now SARS-CoV-2), a new coronavirus associated with human respiratory disease in Wuhan, China (collection date 26/12/2019), was published on GISAID for countries to use in developing specific diagnostic kits. [3]

• The University of Sydney coordinated the notice of release of the genome to the world
• The complete genome sequence called SARS-CoV-2 isolate Wuhan-Hu-1

The virus is closely related genetically to SARS-CoV (82%) and to SARS-related bat and civet coronaviruses within the family Betacoronavirus, subgenus Sarbecovirus. [1, 2]  The epidemiology of this subgenus is largely unknown, especially outside China.

China’s CDC report that on “January 3, 2020, the sequence of novel β-genus coronaviruses (2019-nCoV) was determined from specimens collected from patients in Wuhan by scientists of the National Institute of Viral Disease Control and Prevention (IVDC), and three distinct strains have been established.”

The genome sequence was published by China’s CDC. [5]  The new Betacoronavirus genome sequence was deposited in GISAID (www.gisaid.org) under the accession numbers:

• EPI_ISL_402119
• EPI_ISL_402020 
• EPI_ISL_402121

January 13 2020

WHO releases PCR “diagnostic” protocol – The catalyst for pandemic “cases”

On January 13, 2020 the “WHO publishes the protocol for RT-PCR assay designed by a WHO partner laboratory to diagnose the novel coronavirus”. [ updated V2] Target PCR gene primers and probes from 7 world labs, reinforcing up to 45 cycles of amplification.

WHO “immediately began working with companies to produce high-quality PCR kits that were shipped to laboratories worldwide in early February 2020” [1]

This PCR test protocol was developed by Dr Drosten under “sever time constraints” and was in turn adopted by WHO without any clinical testing to then became the foundation for “diagnosing” COVID-19, and 17 days later generated the “case data” that justified declaring a PHEIC. [2]

PCR is a laboratory technique, also referred to as a Nucleic Acid Amplification Test (NAAT).

The WHO protocol references Christian Dorsten et al, of which their paper was published 10 days later on 23 Jan, after less than 24 hours in peer review, in a journal that Drosten is an editorial member!

By Nov 2020, this paper had been externally peer review finding 10 major scientific flaws, and major conflicts of interest. [3]

WHO released Diagnostic Testing for SARS-CoV-2 – 17 Jan, 19 Mar, 11 Sept 2020.  It wasn’t until the September edition before “clinical” criteria became part of the diagnosis on top of PCR.

Drosten also raced to design the diagnostic test protocol for 2003 SARS and 2009 H1N1 swine flu. [CV]

PCR tests have been the driver of “diagnosing” an “infected case” and to justify the “quarantining” of healthy people referred to as “asymptomatic carriers”.

PCR test with up to 40 cycles of amplification is recommended by CDC and AU health to “avoid false positives”, Dorsten’s paper references 45 cycles, yet in 2014 he stated PCR is not suitable for mass testing and turns healthy people into “statistically ill”.

Kary Mullis, PCR inventer, his patent used 20 cycles as each cycle doubles the initial sample.

WHO pushes “test, test, test” even though they know the PCR tests are meaningless as a diagnostic tool to determine an alleged infection of SARS-CoV-2.

WHO knows “the cycle threshold (Ct) needed to detect virus is inversely proportional to the patient’s viral load.”  This means when virus levels are low a high Ct is required to detect it (>35) and vice versa.

By Jan 2020 WHO reported the CDC had “developed a rRT-PCR test that can diagnose 2019-nCoV.” CDC rushed to produce the test kit and applied for FDA EUA, for a product that states “this test cannot rule out diseases caused by other bacterial or viral pathogens.” [4]

“Since no quantified virus isolates of the 2019-nCoV were available for CDC use at the time the test was developed…for detection of the 2019-nCoV RNA… characterized stocks [computer generated sequences were used] of in vitro transcribed full length RNA”. [2020, 2021]

Watch >>

January 24 2020

CDC publish instructions for use of RT-PCR test

On January 24, 2020 the CDC provided information for laboratories and  publish their instructions for use of Real-Time RT-PCR Panel for Detection 2019-Novel Coronavirus  along with publishing initial PCR “Primers and Probes” sequences [1, 2, 3, 4]

The charts indicated amplifying cycles up to 45, but stated Under Interpreting Test Results tht “RP should be positive at or before 35 cycles for all clinical samples and HSC, thus indicating the presence of sufficient nucleic acid from human RNase P gene and that the specimen is of acceptable quality.”  Their graph indicated the Cycle Threshold (Ct) before the “exponential PCR phase” was between 22 to 28 cycles of amplification.

January 24 2020

Paper describing Wuhan virus sequencing

A paper published in the New England Journal of Medicine entitled “A Novel Coronavirus from Patients with Pneumonia in China, 2019” describes how China CDC scientists took “lower respiratory tract samples…from patients with pneumonia of unknown cause” and “who had been present at the Huanan Seafood Market”.

“Extracted nucleic acid samples [RNA] were tested for viruses and bacteria by polymerase chain reaction” (PCR).  RNA extracted from lung fluid and culture supernatants was used as a template to clone and sequence the genome using genomic software.”  This paper references China’s PCR test.

“Primers were subsequently designed for PCR“.

“Although our study does not fulfill Koch’s postulates, our analyses provide evidence implicating 2019-nCoV in the Wuhan outbreak”.

The resultant genetic sequence that will become known as SARS-CoV-2.  A computer generated sequence of a virus not isolated and purified. [1, 2]

January 30 2020

WHO declares COVID-19 a Public Health Emergency of International Concern

The International Health Regulations (IHR) Emergency Committee for COVID-19 held its first meeting on January 22 & 23, 2020 [found COVID-19 not an emergency], then 7 days later on January 30, 2020 they met again and upon the committee’s advice, the WHO Director-General Tedros Adhanom Ghebreyesuss declared that the novel coronavirus outbreak constituted a Public Health Emergency of International Concern (PHEIC), the “WHO’s highest level of alarm“. [1, 3]

• “The Committee also acknowledged that there are still many unknowns, cases have now been reported in five WHO regions in one month, and human-to-human transmission has occurred outside Wuhan and outside China.”
• “The Committee believes that it is still possible to interrupt virus spread, provided that countries put in place strong measures to detect disease early, isolate and treat cases, trace contacts, and promote social distancing measures commensurate with the risk.”
• “The Committee agreed that the outbreak now meets the criteria for a Public Health Emergency of International Concern.”
• The Committee emphasized that the declaration of a PHEIC should be seen in the spirit of support and appreciation for China, its people, and the actions China has taken on the frontlines of this outbreak, with transparency, and, it is to be hoped, with success. In line with the need for global solidarity, the Committee felt that a global coordinated effort is needed to enhance preparedness in other regions of the world that may need additional support for that.

“A key factor in reaching their decision – which the WHO had initially been reluctant to make – was that the outbreak was no longer limited to China but had spread rapidly to 18 other countries. Among them, Australia, Vietnam and South Korea which all announced new infections today, while India and the Philippines reported their first cases, and the CDC announced the first person-to-person transmission of the virus in the U.S.” [2]

• Australia is represented by Professor John Mackenzie of Curtin University on the Emergency Committee.
• At the time PHEIC was declared 171 people were determined to have died globally from the novel coronavirus. [4]
• Is this the mark for the start of a technocratic “new economic model”?

Only 5 times before has the WHO declared a PHEIC, since its power to do so was established in 2005 with the IHR:

• 2009 pandemic influenza
• 2014 polio resurgence
• 2014 Ebola epidemic in West Africa2016 Zika virus outbreak
• 2019 Ebola outbreak in the Democratic Republic of Congo

January 31 2020

WHO releases COVID-19 Case Definitions

On January 31, 2020 the WHO released their interim guidelines for Case Definitions for Surveillance purposes:

• Suspected case
• Probable case
• Confirmed case

A confirmed case: “A person with laboratory confirmation of 2019-nCoV infection, irrespective of clinical signs and symptoms”

WHO Dec 2020 update:  A Confirmed Case: “A person with a positive Nucleic Acid Amplification Test (NAAT)”, which is simply a positive RT-PCR test,  no symptoms necessary.  A positive PCR result makes a healthy person “statistically ill”.

February 4 2020

CDC release their PCR test to diagnose COVID-19

On Monday, February 3, 2020, CDC submitted an Emergency Use Authorization (EUA) their own product package to the U.S. Food and Drug Administration (FDA) to expedite FDA permitted use in the United States.”  This is to “authorize the use of unapproved, but potentially life-saving medical or diagnostic products during a public health emergency.”

The next day on February 4, 2020, the FDA issued the EUA and the CDC release their  “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-RCR Diagnostic Panel” which is “intended for the presumptive qualitative detection of nucleic acid from the 2019-nCoV…Positive results are indicative of active infection with 2019-nCoV but do not rule out bacterial infection or co-infection with other viruses.”

During the following 21 days after release of the CDC “exclusive” kit, “performance issues were identified related to a problem in the manufacturing of one of the reagents which led to laboratories not being able to verify the test performance.”  By then the virus had spread across the country.  The CDC test kit fiasco had hindered the public health response to the virus.

Which in May 2021 a FOIA revealed that the tests were “poorly designed and came with erroneous instructions that made it doubly difficult for labs to rely on the test’s results” and the CDC lab scientists knew that the tests failed 33% of the time but didn’t stop it’s release.

Load More

The post PCR testing timeline first appeared on Totality of Evidence.