nano-structures | Totality of Evidence https://totalityofevidence.com COVID-19 pandemic timeline and research resource links Sat, 05 Apr 2025 05:07:31 +0000 en-AU hourly 1 https://wordpress.org/?v=7.0.4 https://totalityofevidence.com/wp-content/uploads/2022/01/TE-favicon-150x150.png nano-structures | Totality of Evidence https://totalityofevidence.com 32 32 What is in the COVID-19 Vaccines? https://totalityofevidence.com/what-is-in-the-covid-19-vaccines/ Thu, 11 Aug 2022 00:08:00 +0000 https://totalityofevidence.com/?p=10177 Scientists and doctors around the world have acquired COVID-19 vaccine vials in order to view the solutions under the microscope and perform technical analyses on the solutions in the hope of determining what is actually the injection vials. [Update: This…

The post What is in the COVID-19 Vaccines? first appeared on Totality of Evidence.

]]>
Scientists and doctors around the world have acquired COVID-19 vaccine vials in order to view the solutions under the microscope and perform technical analyses on the solutions in the hope of determining what is actually the injection vials.

[Update: This page is tracking all matters to do with the vials, including DNA contamination from Process 2]

Graphene oxide, foreign looking organisms and angular-shaped, self-assembling nano-structures appear to be some of the “foreign” ingredients in these new, genetic technology products labelled “vaccines”.

Not all vials from the same manufacturer appear to contain the same contents. Such an inconsistency in the manufacturing process is highly concerning.

  • Is there in-consistency in the manufacture of these products? Is this on purpose?
  • Some vials appear to be just saline! Could this explain the “how bad is my batch” trend?
  • What are the strange and foreign-looking structures that are evident under the microscope? Why are they there?
  • We know there are proprietary ingredients in the vaccines, that are hidden from the public, what exactly are these ingredients?

What started scientists to investigate the contents of the COVID-19 vaccines was the magnetism phenomenon that emerged around early to mid May 2021, when social media went viral with people demonstrating how metal objects stuck to their bodies, particularly at their COVID-19 injection sites!

What has been discovered?

This web page is an attempt to capture links to videos, article and reports on the topics that reveal the contents of the COVID-19 vaccine vials. It will be continuously updated, but should not be seen as a complete list. There will be an attempt to add credible sources, but due to time constraints not all material can be vetted, so use your own discernment. Consider this a time capsule of the emerging information.

Orwell City is a great resource to explore

Orwell City is a website started in May 2021, that is dedicated to gathering information that the Spanish research team at La Quinta Columna find, along with others, they are translating the content into English. Orwell is not affiliated with La Quinta Columna. Much thanks to Orwell City, please explore their website for a more comprehensive overview of the vaccine vial findings from La Quinta ColunmaHERE

Be aware that today nanoscience, neuroscience, biotechnology and genomics have advanced tremendously, and the science fiction finding below are very possible!

This is work that our regulatory authorities should be doing to ensure the safety and integrity of these emergency authorised products.

Hydrogels

Nanowerk: Hydrogels were first proposed for biological use in 1960 – Hydrophilic Gels for Biological UseREAD

“Hydrogels are fascinating natural or synthetic polymer materials that exhibit very versatile chemistries and physical or biological properties. They are 3D networks of either physically or chemically crosslinked polymers that resemble organic tissues and that can hold large amounts of water within their interlocked molecular network. In order for a material to be considered a hydrogel, water must constitute at least 10% of its total weight or volume. Hydrogels can be physical, chemical, or biochemical. Hydrogels are considered as drug delivery agents! There are magnetic hydrogels – REF

Hydrogel platform enables versatile data encryption and decryption (2024) – READ, CREDIT

How bad is my batch

  • How Bad is My Batch website – HERE
  • MatchYourBatch.org a free VAERS data search tool – HERE, READ
  • A list of nearly 50 videos on the vaccine batch inconsistencies and content can be found – HERE

May 26, 2021 – Connecticut State: What are the Ingredients of the COVID-19 vaccines? What is in them? – READ, ARCHIVE,

Pfizer-BioNTech

Pfizer-BioNTech – PDF

Moderna

Moderna – PDF
  • Johnson & Johnson vaccine ingredients – PDF
  • TGA: Batch release assessment of COVID-19 vaccines – HERE
  • Dr Ana Maria Mihalcea writes about nanotechnology – HERE

Date? – La Quinta Columna: Reports and Scientific Publications on the Toxicity of Graphene Oxide to Living Organisms and to Humans in Particular – A list of 60 scientific publicationsREPORT, SOURCE

WHO vaccine regulations – Good Manufacturing Practices (GMP) for biological products & Guidelines for quality assurance (QA) – ARCHIVE

Update: this page has evolved to include DNA contamination, Tris buffer, Endotoxins and more.

Discovery links in reverse chronological order

2024

December 18, 2024 – Dystopian Down Under: BOMBSHELL: Australian drug regulator knows DNA fragments in mRNA vaccines can enter nucleus and integrate into genome, internal emails show = The Therapeutic Goods Administration withheld information on DNA contamination risks from the public, presenting a picture of certainty where there is none – READ

November 15, 2024 – Ethical Skeptic: The Saline-Like Effect – US states where politicians and pharma executives reside do not exibit the same serious adverse event profile as other states – TWEET

October 31, 2024 – Russell Broadbent MP: Minister Butler response to Contaminated COVID-19 vaccinesREAD, Julian Gillespie – CREDIT

October 13, 2024 – Julian Gillespie: All 537 Australian Councils to Receive DNA Contamination report – READ

  • Port Headland Special Council Meeting – 13 Nov 2024 – WATCH
  • Professor Angus Dalgleish 10min presentation to Port Headland Councillors – HERE

October 11, 2024 – IJVTPR: At Least 55 Undeclared Chemical Elements Found in COVID-19 Vaccines from AstraZeneca, CanSino, Moderna, Pfizer, Sinopharm and Sputnik V, with Precise ICP-MS by Diblasi et al – PDF, Infowars via Vigilant Fox CREDIT

September 28, 2024 – Club Grubbery: Graham and John have an informal talk with Angus Dalgleish…- WATCH, READ

September 20, 2024 – Russell Broadbent MP: Australians Deserve Answers – READ, CREDIT

  • Official letter is delivered to Prime Minister of Australia, Anthony Albanese calling for the immediate suspension of COVID-19 vaccines due to DNA contamination found in Australian vials of the COVID-19 modRNA vaccine products – LETTER
  • This letter has been copied to Health Minister Butler, the TGA and the Human Rights Commissioner – they have been informed

September 19, 2024 – Julian Gillespie Substack: Australian DNA Contamination: The Final Report.. and Beware of the TGA’s hand waving Misdirection – READ

  • Canadian molecular virologist Dr David Speicher was commissioned to test Australian vials of Pfizer and Moderna’s COVID-19 vaccines, after 8+ Australian labs refused the job.
  • “last week Dr Speicher presented his final report after cautiously taking the time to double-check a round of results first, by undertaking another round with added controls, only to conclude that Yes, indeed, synthetic DNA contamination in Australian vials of Pfizer and Moderna has been off the charts”
  • Gillespie uploaded to ChatGPT Speicher’s DNA contamination report plus the European Medicines Agency (EMA) guidelines ICH Q2(R2) Validation of analytical procedures – because the TGA deferred to this document – ChatGPT in sort concluded Speicher’s methodology “went beyond”appears to go beyond what ICH Q2(R2) covers” – as LNP-modRNA is brand new technology!

September 18, 2024 – PJ O’Brien & Associates Press Release: Study Confirms Synthetic DNA Contamination in Pfizer and Moderna COVID-19 Vaccines in Australia, including kid’s vials – PDF, CREDIT

September 17, 2024 – Dystopian Down Under, Rebekah Barnett’s Substack: BREAKING: DNA contamination in Australian mRNA Covid shots up to 145 time regulatory limit, report shows – READ, Daily Skeptic – READ

  • The first independent testing of Australian vials confirms findings from the US, Canada and Germany, highlighting that oncogenic and genomic integration risks are a global concern

August 19, 2024 – Medicina: Reports of Batch-Dependent Suspected Adverse Events of the BNT162b2 mRNA COVID-19 Vaccine: Comparison of Results from Denmark and Sweden – Manniche, Schmeling, Gilthorp & Hansen (Denmark) – READ, VAERS Aware Danish Batch Study Dashboard – HERE

  • (see March 30, 2023 below) the Danes have updated graph A to include SAE reports from same time period but weren’t published at the time of publication i.e. backlog. Is there still more backlog? – Albert B explains he calls out backlog as actually THROTTLING (purposeful delay publishing). – READ
  • The authors use terminology of “mild severe adverse event” and “severe severe adverse event”, WHAT? – CREDIT
  • “Denmark now has 34,410 registrants consisting of 93,245 SAEs or 2.71 SAEs per report. Conversely Sweden has 56,784 registrants consisting of 219,731 SAEs or 3.87 SAEs per report. This is clearly a big difference and could dramatically skew the comparisons.” – death is a SAE! “…in a different environment we could say that Sweden codes and documents a lot better than Denmark does” – REF
Danish Pfizer batch study – number of suspected adverse events by batch – source
  • The yellow dots from March 30, 2023 publication were called out by some to indicate “placebo” lots….now that more reports are being published by authorities those batches are revealing adverse events.
March 30, 2023 – source, August 19, 2024 – source, ENLARGE
The Yellow dots were called out as “placebo” batches, now that more SAE reports have been published the line is no longer flat!
  • Albert has identified “a minimum of 7 deaths in the yellow dots” batches – REF

September 6, 2024 – Dr John Campbell: mRNA nanostructures – WATCH (not posted to Rumble?)

  • Real-Time Self-Assembly of Stereomicroscopically Visible Artificial Constructions in Incubated Specimens of mRNA Products Mainly from Pfizer and Moderna: A Comprehensive Longitudinal Study Young Mi Lee, MD (Japan) – READ
  • JikkyLeaks warning “Sorry but this is not a believable study” – TWEET

July 4, 2024 – Dystopian Down Under by Rebecca Barnett: Australian drug regulator [Therapeutic Goods Administration (TGA)] goes on record: Pfizer mRNA shots ‘not contaminated’ – READ

  • Yet At least four independent labs around the world claim to have detected excessive levels of plasmid DNA in the mRNA Covid vaccines
  • TGA spokesperson in email communication with Barnett stated unequivocally, “The Pfizer COVID vaccine is not contaminated.”

May 30, 2024 – via Julian Gillespe: Dr David Speicher Preliminary report of DNA Contamination in Australian COVID-19 vaccine vials of Pfizer and Moderna .. NOT safe for Humans – READ

May 19, 2024 – Arkmedic Substack: How many coincidences…before it becomes mathematically impossible? – READ

  • CRISPR needs a PAM (Protospacer Adjacent Motif) sequence i.e. nGG. Is this why Pfizer and Moderna used CGG sequence and codon and not the more optimal CGC? – (WATCH)
  • What are the chances multiple ‘independent” corporate manufactures optimised their sequences to be diverse enough to be patentable yet still retain nGG’s which favor CRISPR technology?
  • Apparently you can’t just produce a code in silico and expect the mRNA to be stable and work at a cellular level. Therefore it is “necessary to experimentally confirm the stability of the structure of optimized nucleic acids.” – so how could Moderna and BioNTech produce their code effectively in a day!?
Of the 42 possible Arginine codons, Pfizer and Moderna preferred the “wrong” CGG the non-optimal codon – source
  • All the main COVID-19 vaccines are 30% different from the viral sequence of the Wuhan strain at a nucleotide level
    • Pfizer BNT162b2 (original Pfizer) vaccine and Astrazeneca vaccine are only 1-2% different from each other!
    • Pfizer original and Pfizer bivalent are only 1% different from each other. Likewise the Moderna original and Moderna bivalent are also only 1-2% different from each other.
    • The synthetic sequences from the 4 manufacturers are more different from the original virus than they are from each other

The 3 vaccine companies [Moderna, BioNTech/Pfizer, Novavax] each developed – overnight and without apparently needing to test them – a codon optimised sequence that they deemed necessary to be 30% different from the original virus strain, yet when they had a year to develop a new version of the vaccine for a new virus strain, they only changed their sequence by 1% (just where the new strain amino acid changes were).

Arkmedic
The 44 nucleotide sequence common to all 3 vaccine codes – source
AAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGG
and coincidentally it ends in end in a CGG PAM sequence

May 18, 2024 – Epoch times: Health Canada has refused on several occasions to confirm whether it made a request to Pfizer for the removal of the Simian Virus 40 (SV40) DNA regulatory sequence in its COVID-19 vaccines. – READ

May 17, 2024 – CHD | Doctors and Scientists: Former Pfizer Employee Reveals Contaminations in COVID Vaccines w/ Melissa McAtee who worked for Pfizer while their COVID mRNA products were in development – WATCH

  • EUA product starts being made with bags with Chinese writing that was very unusual – EXCERPT
  • Graphene oxide internal Pfizer report from Spain- positive – EXCERPT
  • 2021 – Aborted Foetal cell line emails (HEP293) – used in development and confirmatory tests for the COVID-19 vaccine – EXCERPT
  • October 6, 2021 – Melissa was interviewed by Project Veritas –EXCERPT
  • nano-luciferase potentially in the vials, could explain glowing skin, specifically micro-dots over the face – EXCERPT

May 16, 2024 – CHD | The Defender: DNA Contamination in Pfizer COVID Vaccine Exceeded 500 Times Allowable Levels, Study Finds – A new peer-reviewed study raises concerns over inadequate testing methods for measuring DNA impurities in COVID-19 mRNA vaccines. Genomics expert Kevin McKernan critiqued the study’s methods but argued that contamination is still over allowable limits and that current regulations are “entirely unfit for purpose.” – READ, Kevin McKernan – CREDIT

March 21, 2024 – Rebekah Barnett Substack: DNA contamination in Covid vaccines DOES get into human cells, new evidence shows – LNPs deliver contaminant DNA straight to the cellsREAD

  • TGA still believes nothig to see here!

February 19, 2024 – Kevin McKernan Substack | Nepetalacton : More lot surveillance reveals DNA contamination variance – Japanese vialsREAD

  • Batch 1F1042A has the lowest cycle threshold (Ct) score for SV40 ever recorded on a tested lot. A low Ct mean the PCR flourescent reader triggered early, meaning the quantity of DNA to be amplified was high to begin with. This Japanese lot was the most DNA contamination vaccine lot/vial tested to date which is only across a narrow number of actual lot numbers.
  • SV40 is not in every vaccine so its not surprising to get no SV40 signal for the Moderna Spikevax samples.
  • The recent XBB vaccines also contain DNA contamination – they expire 2025 – “expired or non-expired vials both have DNA contamination and both were injected into people.”

January 25, 2024 – PharmaFiles by Aussie17: Biologist Prof. Dr. Ulrike Kammerer from University Hospital of Würzburg in interview with “Frau Antjes Salon” shares her concerns about DNA Plasmid Contaminations, SV40 Promoters and Spidroins in mRNA vaccines – EXCERPT & READ, Fremd DNA in Corona-Impfstoffen? – WATCH

  • This interview provides a comprehensive explanation from A to Z of DNA plasmid integration from Kevin McKernan’s work.
    • Following Kevin McKernan’s work, “to everyone’s complete surprise there was actually complete plasmid DNA inside” the CV19 mRNA vaccine vial sampled, professionals recognised the “high potential danger”.
    • The SV40 is a ‘very strong” promoter-enhancer sequence that “if the completed gene or even the whole plasmid gets into human cells the human RNA production and further mechanisms can actually read and replicate the genes from the plasmid.” Producing random unintended foreign proteins, “permanently” transforming the cells.
    • SV40 promoter-enhancer has “some nasty additional functions” – 1) delivery into the cell nucleus – what caused the original SV40 virus to cause cancer. 2) Normally the DNA gene strand is read in one direction from starting point to end point, with SV40 it can work in the opposite direction as well!
    • They found the gene sequence for the Spike protein “looks a bit strange”, bases that don’t need to be there, the opposite strange revealed a gene sequence that codes for “spider silk” i.e. Spidroin!” Human ribosomes can read this code and thus produce spider silk protein (spidroin) in human cells!
      • These foreign spider silk proteins can’t be broken down and thus accumulate and destroys cells/tissue function! Akin to mad-cow disease [Is this an ecplanation for the fibrous clots seen by embalmers?]

What does the gene information for a spider silk protein do in a manufacturing vector, that is supposed to only produce RNA for the COVID-19 spike protein, SARS-CoV-2 spike protein?

Prof. Dr. Ulrike Kammerer

January 20, 2024 – Pharmafiles Substack: JUST IN: German Public Broadcaster WDR Airs Alarming Segment on DNA Contamination – “May potentially integrate into human DNA”.”I cannot guarantee that there is absolutely no residual risk for the next decades of your life because we simply do not know.” – WATCH & READ

January 18, 2024 – ICAN: BREAKING: ICAN Acquires More Lot Data — This Time for the J&J COVID-19 Vaccine – exclusive lot and dose data – READ

January 8, 2024 – ICAN: BREAKING: ICAN Obtains Data Used to Identify “Hot Lots” of Moderna and Pfizer COVID Vaccines – READ

2023

December 18, 2023 – Brownstone Instituted: FDA Fails to Address DNA Adulteration Concerns by Robert Malone – READ

  • The failure of government regulatory authorities to identify and disclose DNA fragment contamination of the Moderna and Pfizer/BioNTech Covid vaccine products prior to independent laboratories disclosing their contamination study findings has raised serious questions about quality control oversight of the manufacturing processes used to produce these products, as well as their overall safety.

December 17, 2023 – Brownstone Instututed: Modified Spike mRNA: There Are No ‘Desired Proteins’ by Jessica Rose – READ, Mulroney et al. study on Frameshifting creating mutant unexpected proteins – STUDY

  • “Nature publication by Mulroney et al. entitled N1-methylpseudouridylation of mRNA causes +1 ribosomal frameshifting was published on December 6, 2023. The authors showed that N1-methylpseudouridine affects the fidelity of mRNA translation via ribosome stalling resulting in the production multiple, unique, and potentially aberrant proteins by frameshifting
  • December 1, 2023 – OSF Preprints – Ribosomal frameshifting and misreading of mRNA in COVID-19 vaccines produces “off-target” proteins and immune responses eliciting safety concerns: Comment on UK study by Mulroney et al. – by Wiseman, McKernan, Rose et al – READ

December 20, 2023 – ICAN: EXCLUSIVE: J&J (Janssen) Lot and Dose Data Release – Johnson & Johnson COVID-19 Lot Numbers and Dose Data Obtained by ICAN Through FOIA – – READ, The Eagle – CREDIT

December 16, 2023 – PharmaFiles: PlasmidGate Continues to Hit the Airwaves: Servus TV’s “Talk im Hangar-7″ covers DNA Contamination!” – 2nd TV station to cover #PlasmidGate – READ & WATCH

December 14, 2023 – via Jessica Rose Substack: Response Letter from Peter Marks FDA Director of the Center for Biologics Evaluation and Research to Joseph A. Lapado, the Surgeon General of Florida regarding Is SV40 promoter/enhancer DNA present in the COVID-19 product vials? – READ

  • Brownstone Institute by Dr Malone: FDA Fails to Address DNA Adulteration Concerns – “redirect[ion], gaslighting, and stonewalling” – READ

November 22, 2023 – Maryanne Demasi Substack: FDA shuts down enquiries about DNA contamination in covid vaccines – After months of enquiries, the FDA says it will not provide further comment on DNA contamination – READ, Brownstone – READ

November 14, 2023 – Nepalactaon Substack: Shrodinger’s SV40 and p53 – It only exists if you know how to look – READ

  • Little known details from the literature about SV40 promoter’s role in cancer….”its interaction with the guardian of the genome “p53” is one of the more notable issues”. The SV40 promoter is known to bind to p53.

November 6, 2023 – Dr Jessica Rose Substack: What a tangled web we may have weaved -A few words on spider butts, (self-assembling) hydrogels and proteinaceous obstructions discovered in autopsies – READ

  • Open reading frame “ORFs are spans of DNA between start and stop codons. Start and stop codons are the triplets of bases (in messenger RNA) that command the commencement and ending of translation in a protein. Whatever that protein may be.”
  • “The presence of putative ORFs on DNA/RNA vaccine candidates implies that overlapping genes may contribute to the translation of smaller peptides, potentially leading to unintended clinical outcomes, and that the protein-coding potential of DNA/RNA vaccines should be rigorously examined prior to administration” – REF
“…this is more than enough to justify a worldwide moratorium on the modRNA shots…”- source

November 5, 2023 – Corona Ausschuss: Craig Paardekooper: Are the Effects of the Jabs orchestrated? | Sitzung 180: Signale | ENGLISH – WATCH

November 3, 2023 – VAERS Aware Substack | Welcome the Eagle (Albert): Kevin McKernan / David Speicher’s Adulterated Lots Analysis Not As Tight As Is Could Be? Part4 – Lot FL0007 analysis…. – READ More deaths than accounted for and was it a Child lot 6 mth to 15 years?!

  • Be aware “every lot number can be transcribed about twenty different ways” and this could result in burried data such as death associated with a lot. This means reports can be “missed by many computational biologists”. Example below
  • But wait, there’s more…A standard search in VAERS does not reveal everything, it needs a deep dive. An example of a Sanofi Denge Tetravalent curiously with lot number FL0007, but it’s notes reference “Pfizer” and saline dilution, was this actually a Pfizer mRNA vaccine and not Denge – Vaccine is entered by drop-down menu and COVID-19 vaccines (C) and Denge (D) are alphabetically next to each other.
  • Also note the “FL series have Tromethamine buffer” that wasn’t in clinical trials – Geoff Pain – COMMENT
Example Lot FL0007 is not always entered into the system correctly so a standard search for the lot will not reveal all – source

October 30, 2023 – Umbrella News: Pfizer’s Bait and Switch a ‘Gut Punch’ for Informed Consent by Rebekah Barnett – READ – a good summary of how the world became trial guinea pigs!

October 20, 2023 – Sasha Latypova Substack: Breaking: Pfizer is going under the bus…Health Canada miraculously “found” SV40 promoter in Pfizer vials! So many governments are suddenly finding things that have been lost for years… – READ

  • Pfizer stocks falling, Pfizer staff layoffs

October 19, 2023 – PrePrint: DNA fragments detected in monovalent and bivalent Pfizer/BioNTech and Moderna modRNA COVID-19 vaccines from Ontario, Canada: Exploratory dose response relationship with serious adverse events.- McKernan et al – READ, ARCHIVE, Dr Jessica Rose co-author – REF

October 18, 2023 – Australian Medical Professionals Society (AMPS): Too Many Dead – An inquiry into Australia’s excess mortality – with a line up of speakers – READ & WATCH, ARCHIVE

  • Dr Geoff Pain – Comprehensive presentation on Endotoxins in the vaccines, a byproduct of Process 2 (which was not the clinical trial procuct) – WATCH

October 18, 2023 – FLCCC Webinar: DNA Contamination in COVID-19 Vaccines? Dr. Jessica Rose and Dr. Janci Lindsay deep dive – WATCH, BACKUP

October 10, 2023 – Epoch Times: EXCLUSIVE: Health Canada Confirms Undisclosed Presence of DNA Sequence in Pfizer Shot –READ, TWEET, CREDIT

  • Simian Virus 40 (SV40) DNA sequence in Pfizer COVID-19 vaccine, which the manufacture had not previously disclosed

October 10, 2023 – WCH Duplicate: WCH Expert Panel Finds Cancer-Promoting DNA Contamination in Covid-19 Vaccines – READ

October 9, 2023 – WCH Symposium: Urgent Expert Hearing on Reports of DNA Contamination in mRNA VaccinesALL VIDEOS (many more speakers)

  • Kevin McKernan: Plasmid Derived dsDNA Contamination in mRNA “Vaccines” – WATCH
  • Prof Alexandra Henrion-Caude: Why So Many Scientists Are Concerned About DNA Contamination – WATCH
  • Assoc Prof Byram Bridle: Immunological Consequences of DNA Contaminants in modRNA Shots – WATCH
  • Attorney Katie Ashby-Koppens: The Australian GMO Case Against Pfizer and Moderna – WATCH
  • Expert Panel Discussion and Final Statements on Plasmid DNA Contamination in mRNA Vaccines – WATCH

“The allegations are that the Covid-19 mRNA vaccines are genetically modified organisms by way of definition under the Gene Technology Act in Australia, as they are capable of transferring genetic material.”

Katie Ashby-Koppens
Key Statements and Qu answered – WCH source

October 6, 2023 – Daily Clout: Report 86: Pfizer’s Clinical Trial ‘Process 2’ COVID Vaccine Recipients Suffered 2.4X the Adverse Events of Placebo Recipients; ‘Process 2’ Vials Were Contaminated with DNA Plasmids – READ

October 6, 2023 – CHD | Doctors & Scientists w/ Brian Hooker: DNA Contamination in mRNA Shots With Jessica Rose, Ph.D. – WATCH

October 3, 2023 – WCH Press Release: WCH to Host Urgent Expert Hearing on Reports of DNA Contamination in mRNA Vaccines – READ, Hearing on Oct 9th

October 3, 2023 – Dr John Campbell: Pfizer, manufacturing process changed w/ Josh Guetzkow – WATCH, WATCH,

  • Jimmy Dore Show: Pfizer Admits Public Received A DIFFERENT VACCINE Formulation Than One They Tested! – WATCH

October 3, 2023 – Unacceptable Jessica Substack: Remember that 4chan post from 2020? – Is it science fiction? Is it real? re an alleged anonymous Moderna engineer insider – READ

  • “He makes point-form claims as to the differences between what we were told were in the shots versus what he claims are in the shots” – [potential fertility and cancer issues ahead]
  • Jessica states: At this point, I thought it would be interesting to look into the potential validity of the points [the engineer] makes”
  • They indicate two genes: CYP19A1 and CDKN1B, are a part of the mRNA sequence in ‘smaller amounts’.???
    • CYP19A1 which is “Aromatase, also called estrogen synthetase or estrogen synthase, is an enzyme responsible for a key step in the biosynthesis of estrogens” …”estrogen is a category of steroid sex hormone responsible for the development and regulation of the female reproductive system and secondary sex characteristics”
    • “Cyclin-dependent kinase inhibitor 1B (p27Kip1) is an enzyme inhibitor that in humans is encoded by the CDKN1B gene…acts as a tumor suppressor due to its function as a regulator of the cell cycle.”

September 26, 2023 – Phil Harper Substack | The Digger: Open letter to the MHRA – Subject: Notification: Findings Regarding mRNA Vaccine VialsREAD

September 26, 2023 – Sasha Latypova Substack: Dr Lindsay talks to FDA official about Plasmid DNA and SV40 in the vax vials – FDA experts stunning response – READ

  • FDA “think” its lab contamination – “besides we’ve seen no peer reviewed studies to support such a claim”…DNA plasmids in these shots have not been proven to be significantly above regulatory standards.. by peer review…”!!! [Do we need “peer review” to prove manufacture contamination for other products?]
  • “Also, we “feel” neonatal mice are a good model for a competent human immune system…”
  • RE VAERS data its’ just “anti vaxxes clogging up the database” [SERIOUSLY]

September 25, 2023 – Spectator Australia: Scientists ‘shocked’ and ‘alarmed’ at what’s in the mRNA shots – by Rebekah Barnett – READ

September 25, 2023 – Jikkyleaks Twitter(X): all the mechanisms for DNA integration that were found in the Pfizer vaccine in the #plasmidgate investigations by @Kevin_McKernan and @P_J_Buckhaults are also potentially present in Novavax if there is plasmid or BCV contamination. – THREAD, what it memes – TWEET

  • Novavax “added saponin which is a transfectant medium” – TWEET
Sometimes a meme explains it better – THREAD

September 22, 2023 – Maryanne Demasi Substack: EXCLUSIVE: An interview with Buckhaults about DNA contamination in covid vaccines… and the FDA responds – READ (paywall)

September 18, 2023 – Maryanne Demasi Substack: Researchers “alarmed” to find DNA contamination in Pfizer covid-19 vaccine – READ & WATCH

  • Phillip Buckhaults, a cancer genomics expert, and professor at the University of South Carolina testifies before a South Carolina Senate hearing about the discovery of DNA contamination found in Pfizer’s mRNA vaccine

September 18, 2023 – Deutscher Bundestag (Germany): Public meeting of the Petitions Committee – FULL (see time 1hr 29 min) -German Professor Brigitte König fround DNA contaminants in mRNA vaccine vials exceeding regulatory limits, reported by Dr. Jürgen Kirschner – TWEET, CREDIT, WEB (No approval of the pandemic contract with the WHO (from 01:23:50))

September 14, 2023 – SC Senate Hearing – Dr. Janci Lindsay testifies before South Carolina Senate Medical Affairs Ad-Hoc Committee on DHEC. She’s a toxicologist with advanced degrees in molecular biology and biochemistry – WATCH, Jessica Rose – READ

  • Dr Lindsay is toxicologist with advanced degrees in molecular biology and biochemistry. She adds the vitally important information about the presence of the SV40 promoter and enhancer in the plasmids used in the Process 2 manufacturing of the modified mRNA. She also raises the issue of potential LPS contamination, implications of the antibiotic resistance genes and insertional mutagenesis and the risks of cancer.

September 14, 2023 – SC Senate Hearing – University of South Carolina Professor Dr. Phillip Buckhaults testifies before South Carolina Senate Medical Affairs Ad-Hoc Committee on DHEC – DNA contamination etc. – WATCH, READ

September 12, 2023 – Andrew Bridgen MP UK via Instagram: Andrew Bridgen, MP, Calls out the MHRA and Pfizer’s Bait-and-Switch Vaccine Fraud – WATCH, Transcriber B – READ

  • The vaccine in the clinical trials was different to that rolled out to the population. Anaphylaxis wasn’t a concern in the trials but was during rollout, Endotoxin contamination from production process would cause anaphylaxis. Was this the reason for 15 min wait time post jab?

August 25, 2023 – Epoch Times: EXCLUSIVE: Health Canada Not Concerned About Scientists’ Finding of Plasmid DNA Contamination in COVID Shots – READ

  • 2 scientists (Kevin McKernan and Dr. Phillip J. Buckhaults) independently raised red flags about ~18 to 70 times greater than acceptable limits of plasmid DNA contamination in mRNA shots, potentially harmful to human genome

August 23, 2023 – Ask Dr Drew Show: The “Bad Batches” of mRNA: Dr. Vibeke Manniche & Scott Schara w/ Dr. Kelly Victory –WATCH

  • “Dr. Vibeke Manniche (Danish physician, PhD) recently joined John Campbell to discuss a peer-reviewed research paper she coauthored titled “Batch-dependent safety of the BNT16b2 mRNA Covid-19 vaccine” published in the European Journal of Clinical Investigation, which appears to show connections between mRNA adverse reactions and specific batches”

August 10, 2023 – The Highwire Ep 332: The Forbidden Debate – FULL, Keven McKernan interview: Are COVID vaccines contaminated with DNA – WATCH

July 29, 2023 – TWITTER: TGA Batch Release assessment as tracked by citizen The Notebook Traveller on Twitter – batches suddenly “not tested” – THREAD,

  • TGA: Batch release assessment of COVID-19 vaccines – HERE

July 29, 2023 – Nepetalactone Substack by Kevin McKernan: SV40 discussion with Dr. Peter McCullough – READ, Interview WATCH, EXCERPT

  • “Despite us being very clear about our sequencing detecting components of the SV40 virus, the media and fact checkers have gone into overdrive debunking and pre-bunking the claims of SV40 being in the vaccines”
  • SV40 Promoters and Enhancers Contaminate Pfizer-BioNTech COVID-19 Vaccine–DNA from Manufacturing Process Raises Longer Term Cancer Concerns with Multiple Injections- Validated Results from Inspection of Vaccine Vials Reported from Kevin McKernan – WATCH

July 7, 2023 – Sasha Latypova Substack | Due Diligence and Art: Was it 30% placebo? Remember that placebo does not mean saline – the “yellow batches” – READ

  • Kim Iverson Show: BOMBSHELL: New Investigation Finds 1-in-3 Pfizer Vaccine Doses May Have Been a Placebo (Chief Nerd) – TWEET
  • June 30, 2023 – “Vaccination” batches: study proves frightening facts – Punkt.PRERADOVIC with Prof. Dr. Gerald Dyker and Prof. Dr. Jörg Matysik (In German with English subtitles) – re a study by the University of Copenhagen – WATCH
    • The Danish study March 30, 2023 – HERE Note “yellow dot” has to do with the graph below, and not a dot on a vial”
FIGURE 1: Numbers of suspected adverse events (SAEs) after BNT612b2 mRNA vaccination in Denmark (27 December 2020–11 January 2022) according to the number of doses per vaccine batch. Each dot represents a single vaccine batch. – see more [Title of graph mine] – source

June 28, 2023 – Daily Sceptic: Pfizer Vaccine Batches in the EU Were Placebos, Say Scientists by Robert Kogan – READ, cross posted by Dr Malone – Geoff Pain pleads caution ren“Yellow Dots” being Placebo.” – READ

  • The story relates to a paper by Danish researchers Max Schmeling, Vibeke Manniche, and Peter Riis Hansen published in March 2023 – Batch-dependent safety of the BNT162b2 mRNA COVID-19 vaccineREAD
Cross posted via email…so no link just screenshot
  • Dr Jessica Rose chimes in – READ
    • “By the way, this analysis in no way minimizes or undermines the findings in the Schmeling et al. study. They are absolutely right-on about those groupings, at least in the context of the blue and yellow groups.”
  • VaersAware take on the Denmark Study – READ

June 15, 2023 – FDA | Vaccines and Related Biological Products Advisory Committee (VRBPAC) – READ, WATCH – Excerpts show DNA contamination of mRNA vaccine vials, Kevin MKernan – EXCERPT

  • The purpose of this VRPBC meeting was “to discuss and make recommendations on the selection of strain(s) to be included in periodic updated COVID-19 vaccines for the 2023–2024 vaccination campaign”!
  • 182nd Meeting of VRBPAC – Public Comment by Kevin McKernan, CSO Medicinal Genomics presents “Plasmid derived dsDNA contamination in mRNA vaccine” – EXCERPT, timestamp WATCH
    • To produce the vaccines for Clinical trials in vitro transcription process was used BUT for scale up production of the vaccines they changed the process and used E. coli to amplify plasmids, “and it is those plasmids that still remain in the vials”. This process was not tested in the clinical trials.
    • “The Pfizer vaccines specifically had this SV40 promotor which was not disclosed in the expression vector map that was given to the EMA”EXCERPT
    • PCR cycle threshold (Ct) difference between DNA vector and Spike is only 5-7 which means there is an “18-70 fold over the EMA limit [recommendation] of 330mg/mg” of double stranded DNA (dsDNA) contamination of the vector plasmid – EXCERPT
    • Various people around the world have now begun to reproduce these findings! “In 60 minutes, dsDNA contamination can be measured with direct qPCR of the vaccine vials for less than $10/vial using 1/300th of a dose” – EXCERPT
    • There’s a risk of DNA integration into the genome! – 2009 Peden paper refrenced – READ
Vaccine production method slide from Kevin McKernan’s presentation to VRBPAC June 15, 2023 – WATCH

June 7, 2023 – CHD | With the Wind with Dr Paul Thomas: Bait-and-Switch [vaccine batch clinical trial v what the public received] With Josh Guetzkow – WATCH, FULL, Josh Guetzkow – TWEET

June 3, 2023 American Thought Leaders: What’s in the Vials – How Humans Were Used as ‘Lab Rats’ in the COVID Pandemic: Dr. Ryan Cole on Fragmented mRNA, Spike Protein Messages, and the Vaccine ‘Ego’ – WATCH, CREDIT

Spike protein is supposed to weigh about 141 kilodaltons …[we have] nothing at 141that would be a spike protein….My concern scientifically is, these products are making the body make unknown proteins as well to the which we could be having these autoimmune responses.

We know that microRNA’s are a known carcinogen

Dr Cole Excerpts

May 13, 2023 – BMJ : Effect of mRNA Vaccine Manufacturing Processes on Efficacy and Safety Still an Open (Rapid Response to: Covid-19: Researchers face wait for patient level data from Pfizer and Moderna vaccine trials) – by Josh Geutzkow – READ, WATCH, Was the Pfizer/BioNTech vaccine clinical trial a bait-and-switch? – TWEET, Production variability needs answering – TWEET, The Conservative Woman – READ

  • The “manufacturing process, which is an integral part of the regulatory approval process to ensure consistent safety and efficacy outcomes”
  • “An October 2020 amendment to the protocol of the pivotal Pfizer/BioNTech BNT162b2 (Comirnaty) clinical trial (C4591001) indicates that nearly all vaccine doses used in the trial came from ‘clinical batches’ manufactured using what is referred to as ‘Process 1’” – READ
  • “However, in order to upscale production for large-scale distribution of ‘emergency supply’ after authorization, a new method was developed, ‘Process 2
    • “The differences include changes to the DNA template used to transcribe the RNA and the purification phase, as well as the manufacturing process of the lipid nanoparticles.
    • Notably, ‘Process 2’ batches were shown to have substantially lower mRNA integrityREF1, EMA – REF2 Adverse events – TWEET
    • No publicly available comparison of ‘Process 1’ vs ‘Process 2’ doses in 250 trial participants! [250 participants represent the product that the world received!] – TWEET
    • FOIA’d documents reveal ~70% of the trial sites received new batches (process 2) with distinct Pfizer lot numbers after Nov. 19, 2020 – TWEET
    • FOIA’d doc revealed batches should have failed TGA batch analysis – TWEET

May 7, 2023 – A Midwestern Doctor Substack | The Forgotten Side of Medicine: What Can Graphene Oxide Teach Us About Facts and Fictions? – Tips for navigating uncertainty in a world filled with lies – READ, Dr Nass – CREDIT

  • “He explains a very potent concept for processing information, which may be challenging to adopt. However, if you aren’t sure of one right answer, and can teach yourself to keep multiple possibilities in play within your mind before you are able to rule one or more out, and you continue to gather information until the right answer becomes completely clear, you will be able to navigate the swamp of disinformation we are bombarded with effectively.” – Dr Nass
  • “One of the more divisive issues in our movement is if graphene oxide was deliberately added to the vaccines so that they could have nanotech applications within the human body.”

April 30, 2023 – Philip Altman Substack: Q: WHEN IS A “VACCINE” NOT A “VACCINE” – A: When it does not prevent infection or transmission of infection – READ

  • It appears “many batches containing dangerous levels of contaminants including circular DNA called plasmids”
  • “…other contaminants which are also of great concern and these include compounds called endotoxins which are lipopolysaccharides in the cell wall of Gram negative bacteria”
  • TGA Batch release assessment of COVID-19 vaccines – READ
    • “It shows no details of limits of specifications or actual results.”

April 21, 2023 – Epoch Times | Health: RNA-Based Vaccine Technology: The Trojan Horse Did Not Contain mRNA – It Contains modRNA That Genetically Manipulates Healthy Cells READ

  • The behaviour of the immune systems’ B cells and T cells is different when presented with a free floating antigen (conventional vaccine) compared to the “next generation” modified-RNA vaccines which causes they hyjacked cell to present the synthesised foreign (non-human) protein on it’s cell surface – confusing the natural order of things!
  • The “fake” mRNA (modRNA) which is designed to stay in the human body longer than nature intended can result in three problems:
    • 1. The synthetic pseuoduridine can increase transcription error rates when making the spike protein antigen – thus the resultat antigen is not what was programmed
      • we demonstrate that both ψ and m1ψ have a higher propensity to mis-pair with dT in the template DNA during in vitro transcription.” – PAPER
    • 2. Unusually broad “tolerance level” of the “Active Substance” – as shown in European Medicines Agency (EMA) Assessment Report – the modRNA concentration can ranges from 0.37 mg/ml to a maximum of 0.63 mg/ml – an unusally high “allowed” variation for a drug – [the article makes the range claims and references EMA document HERE, though I can’t find the quoted figures, though do see many alarming concerns such as only because of the “current public health emergency” were product concerns “considered acceptable” and Europe granted “conditional marketing authorisation”] – also see – TIMELINE
      • EMA accepted a “minimum of 50% of intact modRNA “which means there can be up to a 3.4-fold variation of the active substance present in different batches”
      • “Since one dose of Comirnaty (Pfizer-BioNTech) represents 0.3 ml containing 30 micrograms of active substance, approximately 13 trillion modRNA molecules will be transferred into the body per injection”
    • 3. modRNA may incorporate into human DNA
      • Zhang et al – embryonic kidney cells – HERE
      • Alden et al – Human live cells – LINE1-mediated integration mechanism proposed – HERE
        • Sperm contains high levels of LINE1 – PDF
      • 8% of human genome originates from retroviruses – [so reverse transcription is a posibility, and has not been ruled out by the “sponsors”, but the media would have you believe diffently]

April 20, 2023 – Rebel News: Genomics expert discovers concerning contents in COVID vaccine vials w/ Kevin McKernan – WATCH & READ, CREDIT

  • Former research and development leader at the Human Genome Project has taken citizen science into his own hands to learn more about what exactly lurks in the vials of the novel COVID-19 injections.

April 16, 2023 – Anandamide Substack: Curious case of nucleocapsid encoding Plasmids colonizing Lab staff- READ

  • October 13, 2022 – American Society of Microbiology: Persistent Nonviral Plasmid Vector in Nasal Tissues Causes False-Positive SARS-CoV-2 Diagnostic Nucleic Acid Tests – Beck et al – READ

April 10, 2023 – ICAN: FDA Lacks Adequate Safety Testing of Lipid Nanoparticles (LNPs) in COVID-19 Vaccines – READ

April 2, 2023 – Expose News: BREAKING: FDA confirms Graphene Oxide is in the mRNA COVID-19 Vaccines after being forced to publish Confidential Pfizer Documents by order of the US Federal Court – READ, The Pfizer document: Structural and Biophysical Characterization of SARS-CoV-2 Spike Glycoprotein (P2 S) as a Vaccine AntigenPDF

  • “One of the most recent documents published by the FDA, saved as 125742_S1_M4_4.2.1 vr vtr 10741.pdf, confirms the use of Graphene Oxide in the manufacturing process of the Pfizer Covid-19 vaccine.”…The article states “it confirms on page 7 that reduced Graphene Oxide is required to manufacture the Pfizer Covid-19 vaccine because it is needed as a base for the lipid nanoparticles.” – [I strike through to warn you. I don’t understand how this conclusion is drawn just because graphene oxide is used in a characterisation study doesn’t mean it is in the vaccine..] – SUBSTACK

March 30, 2023 – European J of Clinical Investigation: Batch-dependent safety of the BNT162b2 mRNA COVID-19 vaccine – Schmeling et al – READ, Jessica Rose Substack: Danish study on lot variation and associations with SAEs – READ, Welcome The Eagle 88 – READ, Dr John Campbell – WATCH, BMJ ref 13 – HERE

  • “The present preliminary findings must be interpreted in the light of several limitations. The DKMA-managed spontaneous SAE reporting system in Denmark is a passive surveillance system akin to the Vaccine Adverse Event Reporting System (VAERS) in the US, and reports from these systems are subject to reporting biases, with potential for both under- and over-reporting, as well as incomplete data and variable quality of the reported information” – REF [Add to this the timing of when authorities release reports]
  • “Their study is very important and more studies like this need to be done.” Jessica Rose – REF
  • “Three distinct clusters of BNT162b2 vaccine batches were identified, with highly variable SAE reporting rates….batches administered at the beginning of the vaccination campaign displaying disproportionally high SAE rates” – New updated report Aug 2024 – READ
Denmark adverse event vaccine batch study – source

March 30, 2023 – Anandimide substack | Kevin McKernan: DNA contamination in 8 vials of Pfizer monovalent mRNA vaccines – lot # FL8095 – all vials are contaminated with high amounts of DNA that is not supposed to be there – READ, Lot #FL8095 associated with 2 deaths and 1262 children injured – READ

  • “8/8 monovalent vaccines sourced from a single case from a single lot of Pfizer monovalent vaccines all fail the EMA specification of 3030:1 RNA:DNA (330ng/mg DNA/RNA). They are over the limit by an order of magnitude (18-70 fold).”
  • 2005 FDA Presentation: Issues Associated With Residual Cell-Substrate DNA (aka contamination) – Slides – PDF

March 25, 2023 – Good Morning CHD Ep 72 | Host Dr Jessica Rose: Contamination of mRNA COVID Products w/ Kevin McKernan (ref under video )- WATCH, Epoch Times – READ, video backup in ARCHIVE

  • Microbiologist Kevin McKernan and his team recently discovered simian virus 40 (SV40) promoters in Pfizer’s and Moderna’s bivalent mRNA COVID shots. – REF

March 17, 2023 – McCullough Substack | Courageous Discourse: Critical Role of Pseudouridine in Synthetic mRNA COVID-19 Vaccines – Wholesale Substitution for Uridine Makes mRNA Hard to Destroy and EfficientREAD

  • Some statistics: the US CDC indicates that:
    • 92% of adults have taken one or more COVID-19 vaccine injections
    • 92% of those have been with an mRNA product (Pfizer or Moderna)
  • No one knows exactly what has been injected into the human body – full ingredient list redacted
  • Morais et al indicate that both Pfizer and Moderna chose development strategies replacing all uridine units with pseudouridine, making the entire strand completely “unnatural” to the human body.” and lasts longer – PDF
  • We now understand the quantity and duration of the disease-promoting and potentially lethal Spike protein cannot be known because the pharmacokinetics and pharmacodynamics of mRNA were not characterized.
  • Regular boosters means “stacking of long-lasting mRNA”…”Repeated administrations of mRNA studded with apparently indestructible pseudouridine may have changed the course of lives forever.”

None of these studies demonstrated complete clearance of mRNA from a group of patients:

  • Fertig et al found lipid nanoparticles with mRNA measurable in plasma for 15 daysREAD
  • Castruita et al demonstrated mRNA in blood out to 28 daysREAD
  • Roltgen et al have found mRNA in lymph nodes 60 days after injection – READ

March 13, 2023 – Daily Sceptic: mRNA Vaccine Contamination Much Worse Than Thought: Jabs “Up to 35%” DNA That Turns Human Cells into Long-Term Spike Protein Factories – READ

March 9, 2023 – Jessica Rose Substack: Follow up on DNA contamination of COVID-19 injectable productsREAD, interview Mar 25 with Kevin McKernan – WATCH

  • “Take Home Message: The left-over expression vectors used to manufacture the mRNAs are at contamination levels 100-fold higher than originally proposed and imply trillions of DNA molecules per dose. This has implications for integration into our genome.” – dsDNA
  • Additional follow up – circular DNAs, as opposed to linear DNAs – READ

March 9, 2023 – Anandamide Substack: Pfizer and Moderna bivalent vaccines contain 20-35% expression vector and are transformation competent in E.coli – READ, Correction made to this – WATCH

  • “[t]he original 1:350 -1:3000 DNA:RNA read count levels likely under estimate the level of plasmid contamination present in the Moderna and Pfizer bivalent vaccines.”
  • “Previous RNA-Seq based estimates of the double stranded DNA contamination in the vaccines significantly under reported the magnitude of the contamination. Using qPCR and electrophoresis, we demonstrate the dsDNA contamination levels are 100 fold higher and imply trillions of DNA molecules per dose.”
  • “Regardless of these hypothetical concerns, the dsDNA contamination exceeds the EMA specifications by several orders of magnitude and further scrutiny should be applied to the endotoxin levels and dsRNA levels in these vaccines.”

March 1, 2023 – Daily Sceptic: mRNA Vaccines Contain DNA That May Turn Human Cells Into Long-Term Spike Protein Factories – Study – READ, CREDIT

  • “The researchers found that the vaccines were contaminated with significant quantities of biological agents known as plasmids. Plasmids are small circular DNA molecules that can replicate in bacteria, …The plasmids found in the mRNA shots contain the DNA that codes for the mRNA that produces the spike protein. A cell that has taken in these plasmids may be able to produce the spike protein indefinitely.”
  • “This is a solid piece of research by a very knowledgeable team.” Dr. Anthony Brookes, Professor of Genomics and Health Data Science at the University of Leicester, told the Daily Sceptic

February 22, 2023 – Kevin McKernan – Why id Pfizer exclude Next Generation Sequencine (NGS) data from EMA? – TWEET, CREDIT

February 20, 2023 – A Midwestern Doctor Substack | The Forgotten Side of Medicine: Dangerous mRNA Vaccine Contaminants Were Just Discovered – A Discussion on Production Quality Control, Bacterial Evolution, Spike Proteins and Antibiotics – READ, Dr Kory – TWEET

  • “One of the major challenges with mass-producing the mRNA vaccines was the number of complex steps (prone to error) that had to be done correctly to create the finalized product….” i.e.:
    • Producing the correct DNA plasmids
    • Giving the DNA plasmids to E. coli bacteria – the process to get the “spike” mRNA
    • Eliminating everything from the brew except the intended mRNA (purify)
  • Fortunately an anonymous Substack recently tested the genetic sequences present in the vialsHERE (see Feb 16 below)
    • Discovering “DNA plasmids were still present at a much higher concentration than the arbitrary threshold set by drug regulators” which has very important implications

February 16, 2023 – Nepatalactone Newsletter: Deep sequencing of the Moderna and Pfizer bivalent vaccines identifies contamination of expression vectors designed for plasmid amplification in bacteriaREAD

  • “Dr. Kevin McKernan and his team who had subjected the mRNA vaccines from Pfizer and Moderna to deep sequencing analysis and found alarming levels of DNA contaminants known as plasmids.” – REF
  • “To our knowledge, this is the first deep sequencing of these products and the first time expression plasmids have been discovered in the vaccines. These are potent contaminants in the vaccines being administered to children. Billions of these contaminants per injection is likely an under estimate of their the entire burden as these plasmids can self replicate in bacterial hosts…

February 13, 2023 – Correlation Research in the Public Interest: Age-stratified COVID-19 vaccine-dose fatality rate for Israel and Australia – Rancourt et al – PDF, Jessica Rose – READ

January 11, 2023 – Sasha Latypova Substack: Fake Western Blots Submitted by Pfizer to Several Regulatory Agencies – #Blotgate – READ, Jessica Rose Substack – READ

  • The mRNA vaccines are “pro-drugs”. “Pfizer never provided full characterization of the protein(s) expressed by the shots.”
  • The Western blot images in Pfizer’s documents submitted to EMA and TGA are fake. They are “perfectly regular and rectangular” in shape which is abnormal. “In real life, there are always some distortions,” to the shape of the blots. (see comparison images below). Regulatory professionals should easily pick this up!
  • “At least three global regulatory agencies – FDA, EMA and TGA, all accepted fake Western blot images…”
Pfizer/BioNTech Western blot – too perfect to be real (#Blotgate) – source
Note: Dr Rose learnt there is a “new technology” machine that automates western blot, an instrument of which Pfizer has 20!
Example of real Western blot with distorted shaped blots – source

Febraury 8, 2022 – Frontiers in Immunology: Are There Hidden Genes in DNA/RNA Vaccines? by Beaudoin et al – READ, CREDIT

January 4, 2023 – Sasha Latypova Substack: Maria Gutschi, PharmD, on Lack of Manufacturing Quality of mRNA Injections – mRNA/DNA injections cannot be manufactured to cGMP standards – READ.

  • Presentation: “Independent analysis of quality issues of the BNT162B2 BioNTech/Pfizer vaccine identified by the European Medicines Agency” by Maria Gutschi – WATCH

January 3, 2023 – Geoff Pain Substack: Relative Lethality of COVID-19 vaccines – who is measuring the casualties? – Ingredients in mRNA jabs (Pfizer & Moderna) – READ

  • Sucrose
  • Sodium Chloride
  • Cholesterol
  • DSPC
  • SM-102 (Moderna)
  • ALC-0159 (Pfizer LNP) “novel” ingredient – No genotoxicity studies conducted – TGA FOIA, degrade to a suspected carcinogen
  • ALC-0315 (Pfizer yes, maybe Moderna) “novel” ingredient
  • PEG2000-DMG
  • Nickel
  • Antimony
  • Other Inorganic Impurities such as short length RNAs and DNA contaminants

2022

December 29, 2022 – Peak Prosperity: mRNA Vaccines bad batches – Australian COVID Released – WATCH, GETTR

December 27, 2022 – Jikkyleaks on Twitter: RE TGA FOI #4077: “HOLY CHEESE 🧀🧀🧀 I have discovered something that should lead to the immediate investigation of the TGA and every drug regulator – Two FOIs prove that there were batches of #Pfizer vaccine that had killed people and should have failed the batch analysis. But they kept jabbing.” – TWEET, CREDIT, Repeat CV19 jab Batch numbers – TWEET, The Bombshell – TWEET, TWEET, FOI 4077 – HERE

  • RED FLAG “DEATH” batch numbers: FL5333, FH3221, FK0738 and FL7649 – TWEET,
    Official TGA batch assessment webpage- READ
  • The Agilent curve showed irregularities in the RNA analysis that was ignored by the TGA – for 4 batch numbers: FL5333, FH3221, FK0738 and FL7649 – all death batches – TWEET
That agilent analysis (which should show a spike at the size of RNA of interest) shows RNA contamination, it shouldn’t be there – TWEET

December 26, 2022 – Geoff Pain Substack: Tromethamine is a Hazardous Substance in Jabs that Must be Banned -Pfizer added Tromethamine to it jabs without any clinical trials as a replacement for Phosphate buffer used in it original 4 formulations – READ

  • Tromethamine is an Endocrine Disruptor and causes Anaphylaxis, its Chemical name tris(hydroxymethyl)aminomethane and it is used as pH buffer –
  • TGA “approved a modified Pfizer injection for young Children aged 5-11 years old, using Tromethamine, also known as Tris, Trometamol or THAM as an ingredient…despite the fact that no trials were conducted with the modified product.”
  • FDA approved on October 29, 2021 – REF, READ

December 23, 2022 – Sasha Latypova Substack: Nobody Knows What is in the Vials – Covid-19 injections are dangerous, non-compliant biological materials. Their production must be stopped until a full investigation can be done – “The mRNA shots do not conform to their label specifications” – READ

December 18, 2022 – Jessica Rose Substack: Graphene oxide conjugated to PEG and PEI as a antigen delivery system- This is a thing… and it makes me wonder why they WOULDN’T be using it now – READ

  • Discussion regarding a 2016 paper published in Nanoscale by Chinese scientists. “Their primary goal was to find out if their adjuvant antigen delivery system, graphene oxide-polyethylene glycol-polyethylenimine (GO-PEG-PEI), would be functional with regard to specific immune stimulation, and/or less toxic than aluminum-based adjuvants.”
  • Jessica asks: “This amazing technology is poised and ready. …Is the so-called lipid nanoparticle not a lipid nanoparticle at all? Is it more akin to a lipid conjugated nanosheet infused with some kind of antigenic payload?”

December 18, 2022 – Ana Maria Mihalcea, MD, PhD Substack: Self Assembly Microtechnology Pfizer Vials Research Updates – Ribbons, Microchips, Optical Communications Cables and Correlation to PEG, Graphene, Hydrogel – READ

December 9, 2022 – Zeee Media: Uncensored: Graphene Ribbons Connecting Nanotech Inside Injections – Shimon Yanowitz & Matt Taylor – WATCH

December 8, 2022 – The Highwire Ep 297: BLEEDING TRUTH – includes Dr Ryan Cole & Del Bigtree look under the microscope at various COVID-19 vaccines and their effect on blood – WATCH

Dr Cole explains some “phenomenon” found under the microscope:

  • The geometric, crystal-like structures others have found in the vaccines are likely cholesterol, salt, or sugar crystals
  • Blood reacted to the pH of the vaccine and instantly made them look “spiky” – its called Echinocytes. The red cell has involuted and the surface proteins stick out like spikes.
  • @1:48:20 – the alleged “parasites” found in the vaccine vials are likely contaminants of stellate trichomes, “star-like” trichomes from the bottom of leaves!

December 7, 2022 – Senator Ron Johnson’s roundtable: Dr Renata Moon found intentionally blank package insert in a box of mRNA COVID-19 vaccine product. So informed consent is impossible to be provided by doctors – WATCH, FULL

November 17, 2022 – Vaccine Safety Research Foundation Ep #56: Vile Ingredients – WATCH

November 12, 2022 – Expose News: If we don’t know what’s in Covid vaccines, how can we know what they’re doing? [an excellent overview] – READ

November 12, 2022 – Spartacus Substack: What’s Really in the Shots? – To graphene or not to graphene, that is the question – READ

November 5, 2022 – Expose News: Scientists suspect Covid Vaccines contain Graphene & Nanotech that is damaging the Immune System & causing Cancer – Dr David Nixon, a Brisbane GP put droplets of vaccine and the blood of vaccinated patients under a dark-field microscope. – READ

October 29, 2021 – FDA Press release: DA Authorizes Pfizer-BioNTech COVID-19 Vaccine for Emergency Use in Children 5 through 11 Years of Age – READ, Buffer changed to Tromethamine READ, CREDIT

  • The FDA approved an untested buffer change “The FDA today also authorized a manufacturing change for the vaccine to include a formulation that uses a different buffer [Tris buffer]; buffers help maintain a vaccine’s pH (a measure of how acidic or alkaline a solution is) and stability. This new formulation is more stable at refrigerated temperatures for longer periods of time, permitting greater flexibility for vaccination providers.”
  • They added a “small dose of a volatile and toxic chemical known as “tromethamine””

September 24, 2022 – NBC News: Less than 4% of eligible people have gotten updated Covid booster shots, one month into the rollout – 7.6 million Americans have received bivalent “booster” – READ, Our World in Data: vaccine uptake – HERE, How bad is my batch – SOURCE

Screen capture Sept 29, 2022 USA vaccine uptake – source, taken from HERE

September 22, 2022 – ReAwaken versus The Great Reset tour: Dr. Sheri Tenpenny | What’s In the COVID-19 Vaccines? – WATCH

September 17, 2022 – “COVID-19 Vaccines: What You Should Have Been Told” a presentation by Jonathan Weissman – WATCH, CREDIT, All the Risks – WEBSITE

October 8, 2022 – Ana Maria Mihalecia Substack: The Reason It Is Not Allowed To Analyze C19 vials in the US is BECAUSE IT IS FEDERAL PROPERTY CLASSIFIED AS A WEAPON – Dr Jane Ruby with Sasha Latypova – READ, WATCH

  • Alleged “documentation to prove that the entire covid plandemic is a DOD operation, planned, owned, funded, and controlled across hundreds of companies, not just Pfizer and Moderna, charged with producing parts of the chemical bioweapons, and in collaboration with the Chinese Communist Party.”

September 6, 2022 – Welcome The Eagle 88: VAERS Bad Batches Hiding In Under-Coded Event Levels – Thousands of myocarditis, cardiac arrests, strokes, embolisms, spontaneous abortions are hiding in the lowest level event category aka “NONE OF ABOVE” – WATCH, DASHBOARD

Category “none of the above” adverse events (screenshot Sept 7, 2022) – source

September 6, 2022 – Epoch Times:: ‘Foreign Metal-Like Objects’ Found in 94 Percent of People Who Took mRNA Vaccines: Italian Doctors: Some ‘appearing as graphene-family super-structures’ – READ, OTHER, Italian Aug22, 2022 – PAPER

  • “Three Italian surgeons published a study analyzing peripheral blood drops from 1,006 symptomatic subjects [one month] after they got a Pfizer/BioNTech or Moderna mRNA injection and found 94% of them to have “aggregation of erythrocytes [red blood cells] and the presence of particles of various shapes and sizes of unclear origin”.
  • Inside the vaccines: metallic particles resembling graphene oxide and possibly other metallic compounds
  • Blood shows “rouleaux stacking”
  • “In our experience as clinicians, these mRNA injections are very unlike traditional ‘vaccines’ and their manufacturers need, in our opinions, to come clean about what is in the injections and why it is there.”

September 5, 2022 – World Council for Health: Dr Sabine Stebel from Germany speaks with the World Council For Health – she runs through the German vaccine analysis report which was released July 6, 2022 – (navigate to video date) – @43min WATCH

September 1, 2022 – Steve Kirsh Substack: Documents leaked from the EMA confirms why we aren’t allowed to analyze the vaccine vials – READ, Video from approx March 2021 by Underdog – WATCH, SUBSTACK, Daily Mail – ARTICLE

  • The findings are all consistent with what I and others have long suspected: the vials are all different. The mRNA is not intact!
  • “The complete, intact mRNA molecule is essential to its potency as a vaccine,” [ref]
  • “The fact that it’s illegal for anyone to analyze the vials (they are government property) doesn’t help inspire confidence at all.”!!!

August 31, 2022 – Stew Peters: Findings in German Study: “Toxic Substances Found in ALL Samples Of C19 Vaccines” – German-Austrian working group of independent scientists, Dr. Sabine StabelWATCH, FULL

  • “The greater the stability of the lipid nanoparticle (LNP) envelope [PEG] the more frequent the vaccine side effects” These scientists have concluded that the polyethylene glycol (PEG) coating of the LNP can affect the side-effect profile.
  • Storage of the vaccines could be critical to the stability of the lipid nanoparticles/PEG, thus affect the “potency” of the vaccine and also the potential for an adverse event – the better they are stored, the greater the risk of side effects!
  • But also “sometimes the size distribution of the LNP are very broad, so they are not very stable”
  • The LNP them selves are still toxic. If they don’t function to pull the mRNA into the cells, they are still in the body and could cause harm. The LD50 is unknown.
  • So the higher the quality of the products the more potential adverse effects!
  • An AI program can determine the difference between vaxxed and unvaxxed blood!

August 22, 2022 – Epoch Times: Unusual Toxic Components Found in COVID Vaccines, ‘Without Exception’: German Scientists (with images) – READ, [See July 6, 2022 below for preliminary REPORT]

  • A group of independent German scientists found toxic components—mostly metallic—in all the AstraZeneca, Pfizer, and Moderna COVID vaccine vial samples they analyzed, “without exception” using modern medical and physical measuring techniques.
  • The findings “build on the work of other researchers in the international community who have described similar findings, such as Dr. Young, Dr. Nagase, Dr. Botha, Dr. Flemming, Dr,Robert Wakeling, and Dr. Noak,” Dr. Janci Lindsay, Ph.D., a toxicologist not involved in the study, told The Epoch Times”

August 19, 2022 – Stew Peters Network | Dr Ruby with Mike Adams: SHOCKING: White Embalmer Clots Are Self Assembling Circuits – WATCH

Mike Adams: These self assembling bio-structures that increase over time, and are harvesting and organising, from the blood, electrically conductive elements such as tin, aluminium and sodium etc. This may be the explanation for “died suddenly” and amputations. They are not “alive”, like prions.


August 12, 2022 – International Journal of Vaccine Theory, Practice, and Research (IJVTPR): Dark -Field Microscopic Analysis on the Blood of 1,006 Symptomatic Persons After Anti-COVID mRNA Injections from Pfizer/BioNtech or Moderna – Giovannini et al – READ, Epoch Times ARTICLE

August 9, 2022 – Ana Maria Mihalcea, MD, PhD Substack: Alarming New Report from Working Group of Vaccine Analysis in Germany and Other Countries -the Vaccines Must Be Stopped Immediately! – READ,
Working Group for COVID Vaccine AnalysisREPORT


August 2, 2022 – Steve Kirsch Substack: Want to know what’s inside the vaccine vials? – One of our colleagues ran a mass spectrometry analysis of 4 vials. – READ

  • Mass Spectrometry of 2 x Moderna and 2 x Pfizer: “He found PEG, but no phosphorus which means he found the lipid nanoparticles, but no payload or preservative. A bunch of blanks. No mRNA.”
  • “Nucleic acids, such as DNA and RNA, have a sugar-phosphate backbone. Even if mRNA in a sample is extremely degraded, elemental phosphorus should still be present.” – REF

July 26, 2022 – ACTA Scientific Medical Sciences: Scanning and Transmission Electron Microscopy Reveals Graphene Oxide in CoV-19 Vaccines by Robert O’Young – PDF, SOURCE

Blood post jab Fig 1b – source
Fig 1: Blood clotting around graphene hydroxide – source
Figure 15 – Trypanosoma Parasite

June 24, 2022 – Orwell City: La Quinta Columna: Analysis of vaccination vial confirms presence of graphene nanoparticles (images shared) – READ, WATCH

July 6, 2022The German Working Group for COVID Vaccine Analysis – summary of preliminary findings – wide-ranging report – READ, PDF They call for the vaccination programmes to be discontinued immediately. – SUBSTACK
This report was sent to all members of the Bundestag, then to authorities, media, a total of over 4000 addresses.-REF

Never in the history of science and medicine has anyone before dared to subject an entire population, an almost entire species, to a medical – not to mention a genetic – experiment.”

  1. Toxic substances were found in all of the samples of COVID-19 vaccine vials – without exception.
  2. The blood samples of all the people who had been vaccinated showed marked changes.
  3. The greater the stability of the [PEG] envelope of lipid nanoparticles, the more frequent are vaccine side effects. (see images below)
The adverse reactions increase the more stable the lipid nanoparticle, stability is derived from the PEG envelope.
source
This image depicts a Lipid Nanoparticle (LNP) and it’s PEG coating.
The PEG holds the LNP together, keeping the mRNA “encapsulated”
source

Analytical tools reportedly used:

  • Scanning Electron Microscopy (SEM),
  • Energy Dispersive X-ray Spectroscopy (EDX),
  • Mass Spectroscopy (MS),
  • Inductively Coupled Plasma Analysis (ICP),
  • Bright Field Microscopy (BFM),
  • Dark Field Microscopy (DFM)
  • Live Blood Image Diagnostics
  • Artificial Intelligence

The German group works in close cooperation with several international groups that are carrying out similar investigations and who have obtained results consistent with our own…thus results have been cross-validated.


May 13, 2022 – Dr. Jane Ruby: ⁣Pfizer New FOIA Reports From Team Enigma Part 1 with Sasha Latypova – WATCH

May 4, 2022 – KLA TV: Michael Yeadon: Corona vaccines batch scandal – “The Hot Lots”WATCH, Alarming Data From Canada and Vaccines Batch Scandal – CREDIT

April 18, 2022 – Western Standard Melanie Risdon: Dr. Nagase reviews images from COVID vaccines, shows no ‘elements of life’ – WATCH, READ, ARTICLE, SOURCE

March 21, 2022? – DR. JANE RUBY Welcomes Team ENIGMA [How bad is my batch] who show proof that human safety was never in the plan for Pfizer – WATCH, BACKUP

March 22, 2022 – Dr Sam Bailey: NZ Scientist Examines Pfizer Jab Under The Microscope – There are now 4 teams working on this in New Zealand and Dr Robin Wakeling has agreed to go public with his findings. – WATCH

March 11, 2022 – International Journal of Vaccine Theory, Practice and Research (IJVTPR): Foreign Materials in Blood Samples of Recipients of COVID-19 Vaccines – Young Mi Lee et al – READ, PDF

March 3, 2022 – The Highwire Ep 257: NEW STUDY: MRNA VACCINES MAY ALTER HUMAN DNA – WATCH

March 1, 2022 – Craig Paardekooper | How bad is my batch?: Examines the Repeating 7-Day Cycle of Vaccinations and DeathsWATCH, READ, TRANSCIPT

  • “…the number of deaths is proportional to number vaccinated, and rises and falls with the number of vaccinated” It’s cyclical, death peaks repeat every 7 days.
Date of vaccination by day of the week (NOT the date of death) by the number of deaths reported following vaccinations occuring on that day. Less people get vaccinated on Sunday and Saturday, than days of the week. A distinct 7 day death cycle appears –source, WATCH

February 24, 2022 – Dr. Jane Ruby: Researcher tells Dr. Jane Ruby: FDA, EMA, MHRA approved COVID-19 vaccines without seeing trial data – featuring Team Enigma’s Sasha Latypova – WATCH, READ

February 8, 2022 – Frontiers in Immunology | Hypothesis & Theory: Are There Hidden Genes in DNA/RNA Vaccines? – Beaudoin et al – READ, CREDIT

  • “The presence of putative [Open Reading Frames] ORFs on DNA/RNA vaccine candidates implies that overlapping genes may contribute to the translation of smaller peptides, potentially leading to unintended clinical outcomes, and that the protein-coding potential of DNA/RNA vaccines should be rigorously examined prior to administration”

January 27, 2022 – DE TV: Where does the shade of gray in the vaccine come from? Questions for BioNTech CEO Uğur Şahin – READ, READ

  • The scientists are Jörg Matysik, Professor of Analytical Chemistry at the University of Leipzig; Gerald Dyker, Professor of Organic Chemistry at the Ruhr University Bochum; Andreas Schnepf, Professor of Inorganic Chemistry at the University of Tübingen and Martin Winkler, Professor of Materials and Process Engineering at the Zurich University of Applied Sciences.
  • ““How does this significant color difference come about; almost all substances used are colorless, so white would be expected. Where does the gray tone come from? Are these impurities?”

January 24, 2022 – European Parliament: Time for the truth on the presence of graphene in the COVID-19 vaccines – READ, SOURCE

January 12, 2022 – How Bad is My Batch: Measure of COVID-19 vaccine’s lethality – READ

January 10, 2022 – Stew Peters Show: CDC Whistleblower Drops Nuke: Deadly Bioweapon Lots Targeting Specific Groups – WATCH

January 8, 2022 – Corona Investigative Committee Session 86 with Dr Mike Yeadon talks on vaccine batches and the pharmaceutical manufacturing process – WATCH, BATCH

January 7, 2022 – Stew Peters Show: Evidence: No Vials Are Safe, Full Stops: Terminate Covid-Injection Program Now – WATCH

January 3, 2022 – Stew Peters Show: BREAKING: Deadly Vax Lot Numbers IDENTIFIED, Still in Circulation! – WATCH

  • A huge percentage of side effects tracked in the CDC’s VAERS database are linked to just a small percentage of the vaccine batches produced by Pfizer and Moderna. This data came from a group calling itself Team Enigma.
  • How Bad is my Batch – WEBSITE, Batch Code Table – HERE

2021

December 18, 2021 – The Truth Barrier | Celia Farber: UK Scientist Reveals Bombshell Data Analysis: Tracks Batches Of Pfizer, Moderna and Janssen, Finds “..Some Batches Are 50 Times Worse Than Others” – “How Bad Is My Batch?” Allows People To Input Batch Code – READ

  • For Australia recording batch number is a standard procedure – READ, ARCHIVE

November 11, 2021 – JMBK.News Substack: Tromethamine: Ingredient Added to Pfizer-BioNTech’s Comirnaty for Children Aged 5 – 11 – READ

November 4, 2021 – Frontiers in Cell & Developmental Biology: The Critical Contribution of Pseudouridine to mRNA COVID-19 Vaccines by Morais et al – READ, PDF, CREDIT

November 2, 2021 – La Quinta Columna: FINAL TECHNICAL REPORT ON GRAPHENE DETECTION IN COVID VACCINES where the presence of Graphene Oxide is determined in the samples from Pfzer, Astrazeneca, Moderna and Janssen – by Prof. Dr. Pablo Campra Madrid, Almerial, Spain – REPORT, SOURCE

Graphene Oxide is determined in the samples from:

  • Pfizer
  • AstraZeneca
  • Moderna
  • Janssen

October 14, 2021 – LifeSite News | Jim Hale : BOMBSHELL: Pfizer whistleblower [Melissa Strickler] says vaccine ‘glows,’ contains toxic luciferase, graphene oxide compounds – READ, WATCH, BACKUP

August 30, 2021 – Orwell City – Graphene oxide and unknown moving elements found in Chiromas flu vaccination vial – READ, WATCH

August 24, 2021 – Orwell City: Electronic component found in AstraZeneca vaccination vial – Graphene oxide isn’t the only nanoelement that goes in the vials. A diode has also been found. – READ, WATCH

August 18, 2021 – Stew Peters | Dr Jane Ruby: VAXXED Patients’ Blood Examined, Horrific Findings Revealed by German Physicians! Dr. Barbel Ghitalla examines blood under the microscope and she also looked at a vial of the Johnson & Johnson jab solution. – WATCH, BACKUP – Also see blood slides in the video.

July 27, 2021 – Orwell City: La Quinta Columna on the Tunable Electrical Conductivity of Graphene – READ

July 25, 2021 – Orwell City: Graphene oxide can be identified through blood tests – READ

July 24, 2021 – Reuters: Fact Check-COVID-19 vaccines do not contain graphene oxide – “Graphene oxide is not used in the manufacture of the Pfizer-BioNTech COVID-19 vaccine,” Pfizer’s Senior Associate of Global Media Relations told Reuters. – READ

July 23, 2021 – Orwell City: Andreas Kalcker’s team confirms evidence of graphene oxide in ‘vaccines’TRANSCRIPT, WATCH, Andreas Kalker’s – WEBSITE

“Dr. Kalcker agrees with La Quinta Columna‘s theories and states that all vaccines contain graphene oxide. A nano-material that shouldn’t be in the vials since it generates very serious problems in people’s health due to its ability to interfere with the body’s electromagnetic fields.”


July 22, 2021 – Orwell City: Spectroscopy analysis reveals 99.5% graphene oxide in Moderna vaccination vial – READ, WATCH

“It is not that the whole vial is graphene, but that when the liquid is purified, the signals obtained from this filtrate show that it is 99.5% graphene.”


July 19, 2021 – Orwell City: BREAKING: Graphene Oxide has been found in Vaxigrip Tetra [flu] vaccination vial – READ, WATCH

July 17, 2021 – Orwell City: La Quinta Columna discusses a study on the properties of graphene and their link with EMF – READ, WATCH

This is one of the papers that bring them closer and closer to prove their hypothesis about the real purpose of the elite with mass and forced vaccination: neuromodulation through a material capable of accepting and emitting the frequencies sent by the 5G antennas.


July 14, 2021 – American Media Periscope: Analysis of the Bioweapons with Dr. Lee Merritt – WATCH, Nurses say the COVID-19 vials are not the same, even in the same batch – TIMESTAMP

July 10, 2021 – Orwell City: La Quinta Columna shares UV fluorescence test results that support the claim that the analyzed vaccination vials contain graphene oxide – READ

July 6, 2021 – Tim Truth: New Vax Study With Electron Microscope Shows Particles Similar To Graphene – WATCH


July 5, 2021 – Orwell City: Find out how La Quinta Columna discovered the connection between graphene oxide and electromagnetic fieldsTRANSCRIPT, WATCH

Excerpt from the transcript:

“I am referring to the magnetic or pseudo-magnetic phenomenon that people acquire after inoculation. A magnetic phenomenon on the one hand, but also one that turns inoculated people into superconductors and …can be measured with a multimeter …

So from there we started to look for what kind of materials or, better said, nanomaterials can cause those kinds of properties inside the body and we came up with some of the candidates. One of them initially was graphene. Graphene inside the body acquires magnetic properties and is a superconductor.

Without yet having any knowledge of what was inside the vial, we realized that the industry or rather the stock market of the graphene industry had high uptrend peaks just as the COVID-19 vaccination campaign was starting at the beginning of the year, late December [2020] and early January [2021]. But also, quite curious, during the flu vaccination campaign. 

…Yes. Graphene can be injected. And, in fact, some scientific papers have already raised the possibility that it could be used as a nanoadjuvant in vaccines. With that hypothesis of suspicion, we did what anyone could have done and what I also recommend that you can do if you have access to a vial.

We had access to a sealed vial from Pfizer…After some time of investigation by Dr. Pablo Campra Madrid, Doctor in Chemical Sciences, Bachelor in Biological Sciences and member of the University of Almeria, we obtained this preliminary report where we are told that there is indeed solid evidence of graphene oxide in the sample and that it is also the main component…”

Ricardo Delgado

Graphene oxide, according to Ricardo Delgado, when inside the body causes:

  • thrombogenicity, thrombi
  • blood clotting
  • post inflammatory syndrome or systemic or multi-organ inflammations
  • causes a collapse of the immune system and cytokine storm (glutathione level dependent)

Inhaled Graphene oxide:

  • spreads evenly throughout the alveolar tract and causes bilateral pneumonia
  • causes inflammation of the mucous membranes and thus loss of taste and smell

They found possible compounds, drugs and treatments could degrade graphene oxide:

  • N-acetylcysteine or glutathione degrades graphene oxide. N-acetylcysteine, which is a precursor of glutathione. [FDA attempting to stop NAC – HERE]
  • They found studies where, within an hour of intravenous glutathione or N-acetylcysteine administration to COVID-19 patients they were taken off ventilators and everything.

[So upon reading this the question comes to mind, were the 2020 COVID-19 diagnosed patients sick as a result of a novel viral infection, or did they become ill following a flu vaccine with possibly graphene oxide, triggered maybe by 5G, or combination of both? – just speculating here as I read this transcript above.]

we suspect with many credible indications that COVID-19 disease is actually the side effect of the introduction of graphene oxide into the body by different ways. [masks, PCR tests, antigen tests etc!]

...We know that, naturally, graphene oxide is eliminated by the levels of glutathione in the body, and that is why we suspect that they propose a second, third and even fourth dose every so often: so that you have your considerable dose of graphene oxide. In short, we are talking about the simultaneous and gradual mass poisoning of the entire world population.”

When we study glutathione, we realize that it begins to fall from the age of 30 onwards, but above all it falls considerably from the age of 65 onwards…children have high glutathione reserves...glutathione is low in the obese, [and those with low] vitamin D

…all the elements of…supposed protection…: masks, PCR tests, swabs, antigen tests and vaccine —the wrongly called vaccine— are precisely all those elements that will potentially cause the disease to develop in the future. 

And why do I say ‘in the future’? When we studied the electromagnetic phenomenon we realized that graphene oxide has what is called an ‘electronic absorption band‘. The electronic excitation, its magnetic resonance is precisely in the third bandwidth of the 5G technology, the one that is being tendered right now and that, remember, has been with us throughout the pandemic. 

We observed that the higher the flu vaccination, the higher the mortality of COVID-19, and logically we saw a relationship. The other relationship was with electromagnetic fields….

READ THE TRANSCRIPT!

June 30, 2021: Orwell City: Official interim report of Pfizer’s vaccination vial analysis explained by Dr. José Luis Sevillano and Ricardo Delgado of La Quinta Columna – READ, WATCH

Under Transmission Electron Microscope: Pfizer vaccine sample at 500nm (left) compared to an image of graphene (carbon nanostructures) from the literature (right) at 200nm which is 2.5 x closer – source

May 29, 2021BluetoothGate: My mother has Bluetooth connectivity – WATCH, READ

  • According to Dr. José Luis Sevillano’s hypothesis, the vaccine is magnetic because of the graphene. It becomes magnetic in contact with the organic fluids and serves as an information storage of the person who has it in the body.” – REPORTS

May 17, 2021 – FDA attempts to stop OTC sales of N-acetyle cysteine, an adjunctive treatment for Covid-19 [This is the precursor for glutathione that degrades graphene oxide!] – READ & READ

May 16, 2021 – ZDnet: Services Australia rebuilds immunisation register with IBM ahead of COVID-19 vaccination rollout – (batch number recording) – READ

  • “Among the additions to AIR’s capabilities…[has] the ability to track the COVID-19 vaccine to person, batch, and vial level.” previous system set up for kids, now they need to track adults!

March 23, 2021 – TGA: Melbourne-manufactured AstraZeneca vaccine is now available for Australians – CSL-Seqirus – ARCHIVE,

  • TGA) approved ” the release of the first four batches (batches 300157P, 300158P, 300160P and 300161P) totalling 832,200 doses for supply”.
  • TGA testing of the vaccine batches in our Canberra laboratories plus review of extensive manufacturing documentation, has ensured that the locally-manufactured vaccine has the exactly the same composition and performance as the overseas-manufactured vaccine, the same quality, and is free of contaminants.”
  • TGA approval is required for each and every batch of any vaccine supplied in Australia.

March 23, 2021 – MagnetGate: Claudia Pacheco, a Chilean teacher reported her case of 2 mobile phones sticking to her arm at her Sinovac COVID-19 vaccine injection site. – WATCH, READ, MORE

  • This MAGNETISM & BLUETOOTH PHENOMENON above are the types of abnormality what spurred scientists to begin looking into the vaccine ingredients – it wasn’t happening with just one brand, and it wasn’t always just the are, though it didn’t occur with everyone vaccinated.
  • What could possibly be in these shots to cause a “vaccine” to attract metal? And why the inconsistency? – More on the magnetism phenomenon – HERE

March 10, 2021 – BMJ Investigation: The EMA covid-19 data leak, and what it tells us about mRNA instability – by Serena Tinari – READ, PDF, Steve Kirsh Substack – CREDIT, Dr Rose Substack – READ

  • In Dec 2021 the European Medicines Agency (EMA) was hacked and 40 megabytes of classified information from the agency’s Vaccine review were published on the dark web.
  • Journalists and academics were sent the leaked documents which show that some early commercial batches of Pfizer-BioNTech’s covid-19 vaccine had lower than expected levels of intact mRNA
  • On Nov 23, 2020, EMA knew about the quality control issues with severely compromised mRNA integrity (ranging from 78% to 55%)….and more READ
  • This would support the finding from “How bad is my batch” – WEBSITE
  • From the “leaked emails of communications between FDA, EMA and MHRA, it is revealed that these 3 regulatory organisations appear to have set a schedule to have the vaccines approved by Christmas, prior to receiving all the necessary evidence to make that approval. – READ

February 19, 2021 – European Medicine Agency | Committee for Medicinal Products for Human Use (CHMP): EMA/707383/2020 – Assessment report for Pfizer’s Comirnaty – PDF, CREDIT

Contains information on what was known about Comirnaty’s Lipid nanoparticles – ALC-0315 and ALC-0159 are functional lipids and DSPC and cholesterol are structural lipids. ALC-0315 and ALC-0159, are classified as novel excipients. Because DSPC is used in “Onpattro” [see 2018 below] it is “justified” as not being novel

  • ALC-0159 (2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide) is included in the formulation to provide a steric barrier to: (pg 42) – “Not for human …therapeutic use” – PDF, Safety Data Sheet – PDF
    • 1) facilitate the control of particle size and homogeneity during manufacturing and product storage, and
    • 2) regulate the association of plasma and proteins with the LNP surface.”
  • ALC-0315 (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) “is an ionizable cationic amino lipid that has been used in combination with other lipids in the formation of lipid nonparticles (LNPs)” – it is not for human …therapeutic use” – PDF, Safety Data Sheet – PDF
  • DSPC (1,2-Distearoyl-sn-glycero-3-phosphocholine) – REF, not for human use – PDF, Safety Data Sheet – PDF
  • “While there was no detectable excretion of either lipid in the urine, the percent of dose excreted unchanged in faeces was ~1% for ALC-0315 and ~50% for ALC-0159”
ALC-0315 – not for human use – PDF, ARCHIVE

The lipid nanopartice lipids can be purchased from cayman chemicals such as “LNP-102” – PDF

2020

November 23, 2020 – RETROSPECT Leaked documents: EMA knew about the quality control issues with severely compromised mRNA integrity (ranging from 78% to 55%)….and more – READ

November 6, 2020 – Vaxxter: Chilling Ingredient Used in the COVID-19 Vaccine – blue blood from horseshoe crabs used to test vaccines are free of bacteria – READ, NY Times – READ, WEF – READ

2019

December 4, 2019 – Nature Nanotechnology: The Onpattro story and the clinical translation of nanomedicines containing nucleic acid-based drugs – Akinc et al – READ Ontattro is a (small interfering) siRNA-based drug – WIKI

  • “The regulatory approval of Onpattro, a lipid nanoparticle-based short interfering RNA drug… paves the way for clinical development of many nucleic acid-based therapies enabled by nanoparticle delivery.”
  • Pfizer’s mRNA vaccine has DSPC and because DSPC is used in “Onpattro” it is “justified” as not being novel – REF

June 25, 2019 – American Chemicals Society: Carriers Break Barriers in Drug Delivery: Endocytosis and Endosomal Escape of Gene Delivery Vectors – Degors et al – READ

  • Old and New model for cationic lipid-mediated endosomal escape of genetic cargo
  • “The use of acid-labile nanocarrier components may provide a potential solution for the “PEG dilemma”, i.e., the prolongation of blood circulation time of gene vectors upon their pegylation that goes at the expense of their endosomal escape capacity”

2018

August 10, 2018 – Science News: The first gene-silencing drug wins FDA approval- Using RNA interference, patisiran prevents symptoms by blocking DNA instructions – READ, WSJ: A New kind of drug – READ, (see Dec 4, 2019 above), NEJM (Phase 3 clinical trial with 225 patients) – READ

  • Partisiran by Alnylam pharmaceuticals is sold under the brand name Onpattro. Onpattro contains DSPC found in Pfizer’s COVID-19 vaccine. Becuase of this 2018 FDA approval DSPC is not considered “novel”
  • August 10, 2018: FDA Press Release: FDA approves first-of-its kind targeted RNA-based therapy to treat a rare disease – READ, Onpattro is considered a 2018 “first in class” drug

The post What is in the COVID-19 Vaccines? first appeared on Totality of Evidence.

]]>