The post Kevin McKernan first appeared on Totality of Evidence.
]]>Kevin McKernan PhD is a highly published microbiologist with a long history in genomic science, he is the former research and development leader at the Human Genome Project and is the founder and CSO Medical Genomics where you can find out more about him. Since the regulatory agencies are not doing the work, Kevin has taken citizen science into his own hands to learn more about what exactly lurks in the vials of the genetic COVID-19 injectable products.
Kevin McKernan was also one of the scientists as part of the International Consortium of Scientists in Life Sciences (ICSLS) who critiqued the Corman-Drosten PCR paper
I became aware of Kevin in an interview with Dr Jessica Rose on March 25, 2023 when they discussed his revelations from deep sequence analysis of COVID-19 mRNA vaccine vials, though I had already bookmarked his work exposing the PCR test deception.
What we do know is, there a large economic motivation for this history to repeat itself and the more aspects of the fraud that we unveil, the better we’ll be at resisting it in the future.
Kevin McKernan, Jan 19, 2024
Official links:
December 27, 2024 – Paul Offit Yard Sale – WATCH
May 30, 2024: National Citizens Inquiry (NCI) 2024 Canada – Kevin McKernan – WATCH
May 18, 2024 – McKernan Substack: Recent DNA Contamination paper by Konig et al – READ
May 4, 2024 – Kevin’s Substack: Scoops Mcgoo reveals a bombshell- FOIA efforts strike gold – READ, Rebel News: Health Canada knew of contamination issues in Pfizer’s shots but rubber-stamped booster doses anyway- WATCH
April 7, 2024 – Kevin’s Substack: DNA sequencing and ‘Market Failure’ – A tour through a wild ride (and J. Rose review of DNA sequencing) – READ
April 6, 2024 – Kevin’s Substack: Targeted Enrichment of vaccine DNA – on the search for genome integration events to ” fish out DNA needles from a haystack” – READ
March 27, 2024 – Kevin’s substack: Week in Review – Lots of DNA integration discussions – READ
March 27, 2024 -Jessica Rose Substack: DNA found integrated in cancer cell line – Implications for people injected with the modified mRNA products, specifically with regard to cancer (Layperson’s summary) – READ
Small amounts of contamination can be amplified inside the cell making the current DNA regulation loop hole large enough to drive a truck through.
Kevin McKernan
March 26, 2024 – Mind & Matters w. Nick Jikomes Ep 149: DNA & RNA Biology, mRNA Vaccines, Vax Contamination & Side Effects, Spike Protein, Ivermectin, Hop Latent Viroid – WATCH, CREDIT
March 13, 2024 – TFTC 489 on X: Bitcoin Fixes Scientific Peer Review with @Kevin_McKernan – WATCH
March 10, 2024 – 2nd Smartest Guy Substack: BREAKING: Integration of corona vaccine-contaminated DNA into the human cell line genome by Mao Arakawa (Okudo Hirokushi) – READ,
February 28, 2024 – FLCCC Weekly Update w/ Dr. Paul Marik and Dr. Pierre Kory: ‘COVID Vaccines & Genome Integration’ – WATCH, READ
February 25, 2024 – Kevin’s Substack: Vaccine targeted qPCR of Cancer Cell Lines treated with BNT162b2 – Putative integration events- READ This is deemed to confirm DNA integration
February 19, 2024 – Kevin McKernan Substack | Nepetalacton : More lot surveillance reveals DNA contamination variance – Japanese vials – READ
January 28, 2024 – Kevin’s Substack: The Pet Theory Economy [Division!] – READ
January 24, 2024 – PharmaFiles Aussie 17: Biologist Prof. Dr. Ulrike Kammerer from University Hospital of Würzburg shares her concerns about DNA Plasmid Contaminations, SV40 Promoters and Spidroins in mRNA vaccines –
January 19, 2024 – Kevin’s Substack: The Smoking Gun – With a confession note – READ, USRTK – READ, WATCH
January 17, 2024 – Kevin on X: What has beating the drum for 3 years accomplished? – THREAD, READ
December 5, 2023 – Rebekah Rarnett Substack: Kevin McKernan loses entire database of research after NZ health service obtains an injunction to prevent sharing of leaked Covid vax health data – READ
November 2, 2023 – Kevin’s Substack: Spider webs in the Pfizer closet – Kurtosis and the Mystery Open Reading Frame (ORF) – READ
November 1, 2023 – Epoch Times: European Regulator Confirms pfizer did not highlight dna sequence in covid-19 vaccine – READ, Zero Hedge – READ
October 19, 2023 – Epoch Times: EXCLUSIVE: Health Canada Confirms Undisclosed Presence of DNA Sequence in Pfizer Shot – READ
October 18, 2023 – Australian Medical Professionals Society (AMPS): Too Many Dead – An inquiry into Australia’s excess mortality – Kevin McKernan presents on DNA contamination findings in the COVID-19 vaccine vials – WATCH, All bio’s and presentations – HERE, Download Book – HERE
October 9, 2023 – WCH Symposium: Urgent Expert Hearing on Reports of DNA Contamination in mRNA Vaccines – ALL VIDEOS (many more speakers)
October 4, 2023 – Daily Clout: Medicinal Genomics Founder and CSO Kevin McKernan Shows Naomi Wolf DNA Fragments in COVID Injections – WATCH
September 25, 2023 – Jikkyleaks Twitter(X): all the mechanisms for DNA integration that were found in the Pfizer vaccine in the #plasmidgate investigations by @Kevin_McKernan and @P_J_Buckhaults are also potentially present in Novavax if there is plasmid or BCV contamination. – THREAD, what it memes – TWEET
September 17, 2023 – PharmaFiles Aussie17 Substack: BREAKING: Dr. Phillip Buckhault‘s Testimony at Senate Hearing on DNA Contamination in Pfizer’s mRNA Vaccine -Hard evidence of DNA Contaminants in Pfizer and Moderna’s “vaccines” -WATCH & READ, CREDIT, Hearing – WATCH, ARCHIVE, BACKUP, BACKUP, BACKUP
August 29, 2023 – Epoch Times | American Thought Leaders: Kevin McKernan Talks COVID Vaccine DNA Contamination, the Monkey Virus SV40 Promoter, and What’s Actually in the Vaccines – WATCH, LISTEN, Substack – READ
August 25, 2023 – Epoch Times: EXCLUSIVE: Health Canada Not Concerned About Scientists’ Finding of Plasmid DNA Contamination in COVID Shots – READ
August 10, 2023 – The Highwire Ep 332: THE FORBIDDEN DEBATE – FULL, Are the COVID-19 Vaccines contaminated with DNA? – WATCH
July 29, 2023 – Nepetalactone Substack by Kevin McKernan: SV40 discussion with Dr. Peter McCullough – READ, Interview WATCH, EXCERPT
July 27, 2023 – Peter McCullough Substack: SV40 Promoters and Enhancers Contaminate Pfizer-BioNTech COVID-19 Vaccine- DNA from Manufacturing Process Raises Longer Term Cancer Concerns with Multiple Injections
Validated Results from Inspection of Vaccine Vials Reported by Kevin McKernan – WATCH & READ
July 18, 2023 – PANDA: Next Generation Sequencing Overview w/ Kevin McKernan – WATCH, CREDIT
June 15, 2023 – FDA | Vaccines and Related Biological Products Advisory Committee (VRBPAC) |182nd Meeting – READ, WATCH – Public Comment by Kevin McKernan presents “Plasmid derived dsDNA contamination in mRNA vaccine” – EXCERPT, timestamp WATCH
April 20, 2023 – Rebel News w/ Tamara Ugolini: Genomics expert discovers concerning contents in COVID vaccine vials w/ Kevin McKernan – WATCH & READ, CREDIT
April 16, 2023 – Kevin’s Substack: Curious case of nucleocapsid encoding Plasmids colonizing Lab staff – READ
April 13, 2023 – Kevin on X: “David Wiseman forwarded me this Pfizer disclosed Vector from an EMA document. Shared it with us after we put our map public. Do you notice anything they left out of their EMA disclosure?” – TWEET, Rebel News – CREDIT
April 12, 2023 – Kevin’s Substack: Sequencing the Pfizer monovalent mRNA vaccines also reveals dual copy 72-bp SV40 Promoter – READ
March 30, 2023 – Anandimide substack | Kevin McKernan: DNA contamination in 8 vials of Pfizer monovalent mRNA vaccines – lot # FL8095 – all vials are contaminated with high amounts of DNA that is not supposed to be there – READ, Lot #FL8095 associated with 2 deaths and 1262 children injured – READ
March 25, 2023 – Good Morning CHD Ep 72 | Host Dr Jessica Rose: Contamination of mRNA COVID Products w/ Kevin McKernan (ref under video )- WATCH, Epoch Times – READ, video backup in ARCHIVE
March 22, 2023 – Kevin McKernan Substack: Rapid Boil Prep for assessing the dsDNA contamination in the Pfizer and Moderna mRNA vaccines – READ
March 18, 2023 – Kevin McKernan Substack: The Med Gen qPCR assay for assessing Pfizer and Moderna DNA contamination – READ
March 17, 2023 – The way and the Truth and the Life: Science & Data Roundtable – Jessica Rose, Kevin McKernan, Stephanie Seneff, Jonothan Couey, Marc Girardot, John Beaudoin – WATCH
March 16, 2023 – Kevin McKernan Substack: Fluorometer and UV spectra of purified Pfizer and Moderna vaccines – READ
March 15, 2023 – Kevin McKernan Substack: DNase and RNase qPCR examination of Pfizer and Moderna bivalent vaccines – READ
March 14, 2023 – Kevin McKernan Substack: Failure of the linearization reaction in the Pfizer bivalent vaccine manufacturing process – READ
March 12, 2023 – Kevin McKernan Substack: Sequencing of RNase A treated Pfizer bivalent vaccines reveals paired-end sequencing evidence of circular plasmids and an inter-vial 72bp variation in the SV40 promoter. – READ
March 9, 2023 – Jessica Rose Substack: Follow up on DNA contamination of COVID-19 injectable products – READ, interview Mar 25 with Kevin McKernan – WATCH
March 8, 2023 – Kevin McKernan Substack: Pfizer and Moderna bivalent vaccines contain 20-35% expression vector and are transformation competent in E.coli – READ
February 22, 2023 – Kevin McKernan – Why id Pfizer exclude Next Generation Sequencine (NGS) data from EMA? – TWEET, CREDIT
February 16, 2023 – Nepatalactone Newsletter: Deep sequencing of the Moderna and Pfizer bivalent vaccines identifies contamination of expression vectors designed for plasmid amplification in bacteria – READ
December 12, 2022 – Rounding the Earth with Mathew Crawford #15: Decentralized Peer Review – A Cryptocurrency Application (w/ Kevin McKernan) – WATCH
November 4, 2022 – Rounding The Earth: Synthetic Fingerprint of SARS-CoV-2 – Alex Washburne and Kevin McKernan – WATCH, READ, CREDIT
September 20, 2022 – Rounding the Earth with Mathew Crawford: Research Censorship – Round Table with Kevin McKernan and Jessica Rose –WATCH
July 11, 2022 – Rebel News w/ Tamara Ugolini: Genomics expert has paper about concerns about vaccine stability censored after favourable peer reveiw – WATCH & READ
November 25, 2021 – OSF Preprints: Differences in Vaccine and SARS-CoV-2 Replication Derived mRNA:Implications for Cell Biology and Future Disease by McKernan, McCullough et al – READ, READ
February 16, 2021 – Bretigne WTMWD #50: Kevin McKernan on the review of the Corman-Drosten PCR methodology that he co-authored – WATCH, References READ, BACKUP
February 10, 2021 – Kevin McKernan on Twitter/X: Evidence of rigged Peer Review @Eurosurveillanc- TWEET, re Corman Drosten review Addendum
January 2, 2021 – PCR Claims: Kevin McKernan – PCR testing insights – WATCH, BACKUP
I don’t think the public understands the boundaries of this PCR test…We really have to educate everybody that this test is not a meaningful measurement of the epidemiology of the disease
Kevin McKernan
December 17, 2020 – CORMAN-DROSTEN REVIEW REPORT by International Consortium of Scientists in Life Sciences (ICSLS) – Addendum – ARCHIVE
November 27, 2020 – International Consortium of Scientists in Life Sciences (ICSLS) – Review report Corman-Drosten et al. Eurosurveillance 2020 – ARCHIVE
October 26, 2020 – Kevin McKernan on Twitter: “The Live-Dead qRT-PCR problem, the testing industrial complex and its impact on society -I never thought the work I did for the human genome project would be weaponized to lock down society. We are now ruled by qPCR right and the transparency on the process is shameful – READ
The post Kevin McKernan first appeared on Totality of Evidence.
]]>The post What is in the COVID-19 Vaccines? first appeared on Totality of Evidence.
]]>[Update: This page is tracking all matters to do with the vials, including DNA contamination from Process 2]
Graphene oxide, foreign looking organisms and angular-shaped, self-assembling nano-structures appear to be some of the “foreign” ingredients in these new, genetic technology products labelled “vaccines”.
Not all vials from the same manufacturer appear to contain the same contents. Such an inconsistency in the manufacturing process is highly concerning.
What started scientists to investigate the contents of the COVID-19 vaccines was the magnetism phenomenon that emerged around early to mid May 2021, when social media went viral with people demonstrating how metal objects stuck to their bodies, particularly at their COVID-19 injection sites!
This web page is an attempt to capture links to videos, article and reports on the topics that reveal the contents of the COVID-19 vaccine vials. It will be continuously updated, but should not be seen as a complete list. There will be an attempt to add credible sources, but due to time constraints not all material can be vetted, so use your own discernment. Consider this a time capsule of the emerging information.
Orwell City is a website started in May 2021, that is dedicated to gathering information that the Spanish research team at La Quinta Columna find, along with others, they are translating the content into English. Orwell is not affiliated with La Quinta Columna. Much thanks to Orwell City, please explore their website for a more comprehensive overview of the vaccine vial findings from La Quinta Colunma – HERE
Be aware that today nanoscience, neuroscience, biotechnology and genomics have advanced tremendously, and the science fiction finding below are very possible!
This is work that our regulatory authorities should be doing to ensure the safety and integrity of these emergency authorised products.
Nanowerk: Hydrogels were first proposed for biological use in 1960 – Hydrophilic Gels for Biological Use – READ
“Hydrogels are fascinating natural or synthetic polymer materials that exhibit very versatile chemistries and physical or biological properties. They are 3D networks of either physically or chemically crosslinked polymers that resemble organic tissues and that can hold large amounts of water within their interlocked molecular network. In order for a material to be considered a hydrogel, water must constitute at least 10% of its total weight or volume. Hydrogels can be physical, chemical, or biochemical. Hydrogels are considered as drug delivery agents! There are magnetic hydrogels – REF
Hydrogel platform enables versatile data encryption and decryption (2024) – READ, CREDIT
May 26, 2021 – Connecticut State: What are the Ingredients of the COVID-19 vaccines? What is in them? – READ, ARCHIVE,
Date? – La Quinta Columna: Reports and Scientific Publications on the Toxicity of Graphene Oxide to Living Organisms and to Humans in Particular – A list of 60 scientific publications – REPORT, SOURCE
WHO vaccine regulations – Good Manufacturing Practices (GMP) for biological products & Guidelines for quality assurance (QA) – ARCHIVE
Update: this page has evolved to include DNA contamination, Tris buffer, Endotoxins and more.
December 18, 2024 – Dystopian Down Under: BOMBSHELL: Australian drug regulator knows DNA fragments in mRNA vaccines can enter nucleus and integrate into genome, internal emails show = The Therapeutic Goods Administration withheld information on DNA contamination risks from the public, presenting a picture of certainty where there is none – READ
November 15, 2024 – Ethical Skeptic: The Saline-Like Effect – US states where politicians and pharma executives reside do not exibit the same serious adverse event profile as other states – TWEET
October 31, 2024 – Russell Broadbent MP: Minister Butler response to Contaminated COVID-19 vaccines – READ, Julian Gillespie – CREDIT
October 13, 2024 – Julian Gillespie: All 537 Australian Councils to Receive DNA Contamination report – READ
October 11, 2024 – IJVTPR: At Least 55 Undeclared Chemical Elements Found in COVID-19 Vaccines from AstraZeneca, CanSino, Moderna, Pfizer, Sinopharm and Sputnik V, with Precise ICP-MS by Diblasi et al – PDF, Infowars via Vigilant Fox CREDIT
September 28, 2024 – Club Grubbery: Graham and John have an informal talk with Angus Dalgleish…- WATCH, READ
September 20, 2024 – Russell Broadbent MP: Australians Deserve Answers – READ, CREDIT
September 19, 2024 – Julian Gillespie Substack: Australian DNA Contamination: The Final Report.. and Beware of the TGA’s hand waving Misdirection – READ
September 18, 2024 – PJ O’Brien & Associates Press Release: Study Confirms Synthetic DNA Contamination in Pfizer and Moderna COVID-19 Vaccines in Australia, including kid’s vials – PDF, CREDIT
September 17, 2024 – Dystopian Down Under, Rebekah Barnett’s Substack: BREAKING: DNA contamination in Australian mRNA Covid shots up to 145 time regulatory limit, report shows – READ, Daily Skeptic – READ
August 19, 2024 – Medicina: Reports of Batch-Dependent Suspected Adverse Events of the BNT162b2 mRNA COVID-19 Vaccine: Comparison of Results from Denmark and Sweden – Manniche, Schmeling, Gilthorp & Hansen (Denmark) – READ, VAERS Aware Danish Batch Study Dashboard – HERE
September 6, 2024 – Dr John Campbell: mRNA nanostructures – WATCH (not posted to Rumble?)
July 4, 2024 – Dystopian Down Under by Rebecca Barnett: Australian drug regulator [Therapeutic Goods Administration (TGA)] goes on record: Pfizer mRNA shots ‘not contaminated’ – READ
May 30, 2024 – via Julian Gillespe: Dr David Speicher Preliminary report of DNA Contamination in Australian COVID-19 vaccine vials of Pfizer and Moderna .. NOT safe for Humans – READ
May 19, 2024 – Arkmedic Substack: How many coincidences…before it becomes mathematically impossible? – READ
The 3 vaccine companies [Moderna, BioNTech/Pfizer, Novavax] each developed – overnight and without apparently needing to test them – a codon optimised sequence that they deemed necessary to be 30% different from the original virus strain, yet when they had a year to develop a new version of the vaccine for a new virus strain, they only changed their sequence by 1% (just where the new strain amino acid changes were).
Arkmedic
AAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGG
May 18, 2024 – Epoch times: Health Canada has refused on several occasions to confirm whether it made a request to Pfizer for the removal of the Simian Virus 40 (SV40) DNA regulatory sequence in its COVID-19 vaccines. – READ
May 17, 2024 – CHD | Doctors and Scientists: Former Pfizer Employee Reveals Contaminations in COVID Vaccines w/ Melissa McAtee who worked for Pfizer while their COVID mRNA products were in development – WATCH
May 16, 2024 – CHD | The Defender: DNA Contamination in Pfizer COVID Vaccine Exceeded 500 Times Allowable Levels, Study Finds – A new peer-reviewed study raises concerns over inadequate testing methods for measuring DNA impurities in COVID-19 mRNA vaccines. Genomics expert Kevin McKernan critiqued the study’s methods but argued that contamination is still over allowable limits and that current regulations are “entirely unfit for purpose.” – READ, Kevin McKernan – CREDIT
March 21, 2024 – Rebekah Barnett Substack: DNA contamination in Covid vaccines DOES get into human cells, new evidence shows – LNPs deliver contaminant DNA straight to the cells – READ
February 19, 2024 – Kevin McKernan Substack | Nepetalacton : More lot surveillance reveals DNA contamination variance – Japanese vials – READ
January 25, 2024 – PharmaFiles by Aussie17: Biologist Prof. Dr. Ulrike Kammerer from University Hospital of Würzburg in interview with “Frau Antjes Salon” shares her concerns about DNA Plasmid Contaminations, SV40 Promoters and Spidroins in mRNA vaccines – EXCERPT & READ, Fremd DNA in Corona-Impfstoffen? – WATCH
What does the gene information for a spider silk protein do in a manufacturing vector, that is supposed to only produce RNA for the COVID-19 spike protein, SARS-CoV-2 spike protein?
Prof. Dr. Ulrike Kammerer
January 20, 2024 – Pharmafiles Substack: JUST IN: German Public Broadcaster WDR Airs Alarming Segment on DNA Contamination – “May potentially integrate into human DNA”.”I cannot guarantee that there is absolutely no residual risk for the next decades of your life because we simply do not know.” – WATCH & READ
January 18, 2024 – ICAN: BREAKING: ICAN Acquires More Lot Data — This Time for the J&J COVID-19 Vaccine – exclusive lot and dose data – READ
January 8, 2024 – ICAN: BREAKING: ICAN Obtains Data Used to Identify “Hot Lots” of Moderna and Pfizer COVID Vaccines – READ
December 18, 2023 – Brownstone Instituted: FDA Fails to Address DNA Adulteration Concerns by Robert Malone – READ
December 17, 2023 – Brownstone Instututed: Modified Spike mRNA: There Are No ‘Desired Proteins’ by Jessica Rose – READ, Mulroney et al. study on Frameshifting creating mutant unexpected proteins – STUDY
December 20, 2023 – ICAN: EXCLUSIVE: J&J (Janssen) Lot and Dose Data Release – Johnson & Johnson COVID-19 Lot Numbers and Dose Data Obtained by ICAN Through FOIA – – READ, The Eagle – CREDIT
December 16, 2023 – PharmaFiles: PlasmidGate Continues to Hit the Airwaves: Servus TV’s “Talk im Hangar-7″ covers DNA Contamination!” – 2nd TV station to cover #PlasmidGate – READ & WATCH
December 14, 2023 – via Jessica Rose Substack: Response Letter from Peter Marks FDA Director of the Center for Biologics Evaluation and Research to Joseph A. Lapado, the Surgeon General of Florida regarding Is SV40 promoter/enhancer DNA present in the COVID-19 product vials? – READ
November 22, 2023 – Maryanne Demasi Substack: FDA shuts down enquiries about DNA contamination in covid vaccines – After months of enquiries, the FDA says it will not provide further comment on DNA contamination – READ, Brownstone – READ
November 14, 2023 – Nepalactaon Substack: Shrodinger’s SV40 and p53 – It only exists if you know how to look – READ
November 6, 2023 – Dr Jessica Rose Substack: What a tangled web we may have weaved -A few words on spider butts, (self-assembling) hydrogels and proteinaceous obstructions discovered in autopsies – READ
November 5, 2023 – Corona Ausschuss: Craig Paardekooper: Are the Effects of the Jabs orchestrated? | Sitzung 180: Signale | ENGLISH – WATCH
November 3, 2023 – VAERS Aware Substack | Welcome the Eagle (Albert): Kevin McKernan / David Speicher’s Adulterated Lots Analysis Not As Tight As Is Could Be? Part4 – Lot FL0007 analysis…. – READ More deaths than accounted for and was it a Child lot 6 mth to 15 years?!
October 30, 2023 – Umbrella News: Pfizer’s Bait and Switch a ‘Gut Punch’ for Informed Consent by Rebekah Barnett – READ – a good summary of how the world became trial guinea pigs!
October 20, 2023 – Sasha Latypova Substack: Breaking: Pfizer is going under the bus…Health Canada miraculously “found” SV40 promoter in Pfizer vials! So many governments are suddenly finding things that have been lost for years… – READ
October 19, 2023 – PrePrint: DNA fragments detected in monovalent and bivalent Pfizer/BioNTech and Moderna modRNA COVID-19 vaccines from Ontario, Canada: Exploratory dose response relationship with serious adverse events.- McKernan et al – READ, ARCHIVE, Dr Jessica Rose co-author – REF
October 18, 2023 – Australian Medical Professionals Society (AMPS): Too Many Dead – An inquiry into Australia’s excess mortality – with a line up of speakers – READ & WATCH, ARCHIVE
October 18, 2023 – FLCCC Webinar: DNA Contamination in COVID-19 Vaccines? Dr. Jessica Rose and Dr. Janci Lindsay deep dive – WATCH, BACKUP
October 10, 2023 – Epoch Times: EXCLUSIVE: Health Canada Confirms Undisclosed Presence of DNA Sequence in Pfizer Shot –READ, TWEET, CREDIT
October 10, 2023 – WCH Duplicate: WCH Expert Panel Finds Cancer-Promoting DNA Contamination in Covid-19 Vaccines – READ
October 9, 2023 – WCH Symposium: Urgent Expert Hearing on Reports of DNA Contamination in mRNA Vaccines – ALL VIDEOS (many more speakers)
“The allegations are that the Covid-19 mRNA vaccines are genetically modified organisms by way of definition under the Gene Technology Act in Australia, as they are capable of transferring genetic material.”
Katie Ashby-Koppens
October 6, 2023 – Daily Clout: Report 86: Pfizer’s Clinical Trial ‘Process 2’ COVID Vaccine Recipients Suffered 2.4X the Adverse Events of Placebo Recipients; ‘Process 2’ Vials Were Contaminated with DNA Plasmids – READ
October 6, 2023 – CHD | Doctors & Scientists w/ Brian Hooker: DNA Contamination in mRNA Shots With Jessica Rose, Ph.D. – WATCH
October 3, 2023 – WCH Press Release: WCH to Host Urgent Expert Hearing on Reports of DNA Contamination in mRNA Vaccines – READ, Hearing on Oct 9th
October 3, 2023 – Dr John Campbell: Pfizer, manufacturing process changed w/ Josh Guetzkow – WATCH, WATCH,
October 3, 2023 – Unacceptable Jessica Substack: Remember that 4chan post from 2020? – Is it science fiction? Is it real? re an alleged anonymous Moderna engineer insider – READ
September 26, 2023 – Phil Harper Substack | The Digger: Open letter to the MHRA – Subject: Notification: Findings Regarding mRNA Vaccine Vials – READ
September 26, 2023 – Sasha Latypova Substack: Dr Lindsay talks to FDA official about Plasmid DNA and SV40 in the vax vials – FDA experts stunning response – READ
September 25, 2023 – Spectator Australia: Scientists ‘shocked’ and ‘alarmed’ at what’s in the mRNA shots – by Rebekah Barnett – READ
September 25, 2023 – Jikkyleaks Twitter(X): all the mechanisms for DNA integration that were found in the Pfizer vaccine in the #plasmidgate investigations by @Kevin_McKernan and @P_J_Buckhaults are also potentially present in Novavax if there is plasmid or BCV contamination. – THREAD, what it memes – TWEET
September 22, 2023 – Maryanne Demasi Substack: EXCLUSIVE: An interview with Buckhaults about DNA contamination in covid vaccines… and the FDA responds – READ (paywall)
September 18, 2023 – Maryanne Demasi Substack: Researchers “alarmed” to find DNA contamination in Pfizer covid-19 vaccine – READ & WATCH
September 18, 2023 – Deutscher Bundestag (Germany): Public meeting of the Petitions Committee – FULL (see time 1hr 29 min) -German Professor Brigitte König fround DNA contaminants in mRNA vaccine vials exceeding regulatory limits, reported by Dr. Jürgen Kirschner – TWEET, CREDIT, WEB (No approval of the pandemic contract with the WHO (from 01:23:50))
September 14, 2023 – SC Senate Hearing – Dr. Janci Lindsay testifies before South Carolina Senate Medical Affairs Ad-Hoc Committee on DHEC. She’s a toxicologist with advanced degrees in molecular biology and biochemistry – WATCH, Jessica Rose – READ
September 14, 2023 – SC Senate Hearing – University of South Carolina Professor Dr. Phillip Buckhaults testifies before South Carolina Senate Medical Affairs Ad-Hoc Committee on DHEC – DNA contamination etc. – WATCH, READ
September 12, 2023 – Andrew Bridgen MP UK via Instagram: Andrew Bridgen, MP, Calls out the MHRA and Pfizer’s Bait-and-Switch Vaccine Fraud – WATCH, Transcriber B – READ
August 25, 2023 – Epoch Times: EXCLUSIVE: Health Canada Not Concerned About Scientists’ Finding of Plasmid DNA Contamination in COVID Shots – READ
August 23, 2023 – Ask Dr Drew Show: The “Bad Batches” of mRNA: Dr. Vibeke Manniche & Scott Schara w/ Dr. Kelly Victory –WATCH
August 10, 2023 – The Highwire Ep 332: The Forbidden Debate – FULL, Keven McKernan interview: Are COVID vaccines contaminated with DNA – WATCH
July 29, 2023 – TWITTER: TGA Batch Release assessment as tracked by citizen The Notebook Traveller on Twitter – batches suddenly “not tested” – THREAD,
July 29, 2023 – Nepetalactone Substack by Kevin McKernan: SV40 discussion with Dr. Peter McCullough – READ, Interview WATCH, EXCERPT
July 7, 2023 – Sasha Latypova Substack | Due Diligence and Art: Was it 30% placebo? Remember that placebo does not mean saline – the “yellow batches” – READ
June 28, 2023 – Daily Sceptic: Pfizer Vaccine Batches in the EU Were Placebos, Say Scientists by Robert Kogan – READ, cross posted by Dr Malone – Geoff Pain pleads caution ren“Yellow Dots” being Placebo.” – READ
June 15, 2023 – FDA | Vaccines and Related Biological Products Advisory Committee (VRBPAC) – READ, WATCH – Excerpts show DNA contamination of mRNA vaccine vials, Kevin MKernan – EXCERPT
June 7, 2023 – CHD | With the Wind with Dr Paul Thomas: Bait-and-Switch [vaccine batch clinical trial v what the public received] With Josh Guetzkow – WATCH, FULL, Josh Guetzkow – TWEET
June 3, 2023 American Thought Leaders: What’s in the Vials – How Humans Were Used as ‘Lab Rats’ in the COVID Pandemic: Dr. Ryan Cole on Fragmented mRNA, Spike Protein Messages, and the Vaccine ‘Ego’ – WATCH, CREDIT
Spike protein is supposed to weigh about 141 kilodaltons …[we have] nothing at 141that would be a spike protein….My concern scientifically is, these products are making the body make unknown proteins as well to the which we could be having these autoimmune responses.
We know that microRNA’s are a known carcinogen
Dr Cole Excerpts
May 13, 2023 – BMJ : Effect of mRNA Vaccine Manufacturing Processes on Efficacy and Safety Still an Open (Rapid Response to: Covid-19: Researchers face wait for patient level data from Pfizer and Moderna vaccine trials) – by Josh Geutzkow – READ, WATCH, Was the Pfizer/BioNTech vaccine clinical trial a bait-and-switch? – TWEET, Production variability needs answering – TWEET, The Conservative Woman – READ
May 7, 2023 – A Midwestern Doctor Substack | The Forgotten Side of Medicine: What Can Graphene Oxide Teach Us About Facts and Fictions? – Tips for navigating uncertainty in a world filled with lies – READ, Dr Nass – CREDIT
April 30, 2023 – Philip Altman Substack: Q: WHEN IS A “VACCINE” NOT A “VACCINE” – A: When it does not prevent infection or transmission of infection – READ
April 21, 2023 – Epoch Times | Health: RNA-Based Vaccine Technology: The Trojan Horse Did Not Contain mRNA – It Contains modRNA That Genetically Manipulates Healthy Cells – READ
April 20, 2023 – Rebel News: Genomics expert discovers concerning contents in COVID vaccine vials w/ Kevin McKernan – WATCH & READ, CREDIT
April 16, 2023 – Anandamide Substack: Curious case of nucleocapsid encoding Plasmids colonizing Lab staff- READ
April 10, 2023 – ICAN: FDA Lacks Adequate Safety Testing of Lipid Nanoparticles (LNPs) in COVID-19 Vaccines – READ
April 2, 2023 – Expose News: BREAKING: FDA confirms Graphene Oxide is in the mRNA COVID-19 Vaccines after being forced to publish Confidential Pfizer Documents by order of the US Federal Court – READ, The Pfizer document: Structural and Biophysical Characterization of SARS-CoV-2 Spike Glycoprotein (P2 S) as a Vaccine Antigen – PDF
March 30, 2023 – European J of Clinical Investigation: Batch-dependent safety of the BNT162b2 mRNA COVID-19 vaccine – Schmeling et al – READ, Jessica Rose Substack: Danish study on lot variation and associations with SAEs – READ, Welcome The Eagle 88 – READ, Dr John Campbell – WATCH, BMJ ref 13 – HERE
March 30, 2023 – Anandimide substack | Kevin McKernan: DNA contamination in 8 vials of Pfizer monovalent mRNA vaccines – lot # FL8095 – all vials are contaminated with high amounts of DNA that is not supposed to be there – READ, Lot #FL8095 associated with 2 deaths and 1262 children injured – READ
March 25, 2023 – Good Morning CHD Ep 72 | Host Dr Jessica Rose: Contamination of mRNA COVID Products w/ Kevin McKernan (ref under video )- WATCH, Epoch Times – READ, video backup in ARCHIVE
March 17, 2023 – McCullough Substack | Courageous Discourse: Critical Role of Pseudouridine in Synthetic mRNA COVID-19 Vaccines – Wholesale Substitution for Uridine Makes mRNA Hard to Destroy and Efficient – READ
None of these studies demonstrated complete clearance of mRNA from a group of patients:
March 13, 2023 – Daily Sceptic: mRNA Vaccine Contamination Much Worse Than Thought: Jabs “Up to 35%” DNA That Turns Human Cells into Long-Term Spike Protein Factories – READ
March 9, 2023 – Jessica Rose Substack: Follow up on DNA contamination of COVID-19 injectable products – READ, interview Mar 25 with Kevin McKernan – WATCH
March 9, 2023 – Anandamide Substack: Pfizer and Moderna bivalent vaccines contain 20-35% expression vector and are transformation competent in E.coli – READ, Correction made to this – WATCH
March 1, 2023 – Daily Sceptic: mRNA Vaccines Contain DNA That May Turn Human Cells Into Long-Term Spike Protein Factories – Study – READ, CREDIT
February 22, 2023 – Kevin McKernan – Why id Pfizer exclude Next Generation Sequencine (NGS) data from EMA? – TWEET, CREDIT
February 20, 2023 – A Midwestern Doctor Substack | The Forgotten Side of Medicine: Dangerous mRNA Vaccine Contaminants Were Just Discovered – A Discussion on Production Quality Control, Bacterial Evolution, Spike Proteins and Antibiotics – READ, Dr Kory – TWEET
February 16, 2023 – Nepatalactone Newsletter: Deep sequencing of the Moderna and Pfizer bivalent vaccines identifies contamination of expression vectors designed for plasmid amplification in bacteria – READ
February 13, 2023 – Correlation Research in the Public Interest: Age-stratified COVID-19 vaccine-dose fatality rate for Israel and Australia – Rancourt et al – PDF, Jessica Rose – READ
January 11, 2023 – Sasha Latypova Substack: Fake Western Blots Submitted by Pfizer to Several Regulatory Agencies – #Blotgate – READ, Jessica Rose Substack – READ
Febraury 8, 2022 – Frontiers in Immunology: Are There Hidden Genes in DNA/RNA Vaccines? by Beaudoin et al – READ, CREDIT
January 4, 2023 – Sasha Latypova Substack: Maria Gutschi, PharmD, on Lack of Manufacturing Quality of mRNA Injections – mRNA/DNA injections cannot be manufactured to cGMP standards – READ.
January 3, 2023 – Geoff Pain Substack: Relative Lethality of COVID-19 vaccines – who is measuring the casualties? – Ingredients in mRNA jabs (Pfizer & Moderna) – READ
December 29, 2022 – Peak Prosperity: mRNA Vaccines bad batches – Australian COVID Released – WATCH, GETTR
December 27, 2022 – Jikkyleaks on Twitter: RE TGA FOI #4077: “HOLY CHEESE I have discovered something that should lead to the immediate investigation of the TGA and every drug regulator – Two FOIs prove that there were batches of #Pfizer vaccine that had killed people and should have failed the batch analysis. But they kept jabbing.” – TWEET, CREDIT, Repeat CV19 jab Batch numbers – TWEET, The Bombshell – TWEET, TWEET, FOI 4077 – HERE
December 26, 2022 – Geoff Pain Substack: Tromethamine is a Hazardous Substance in Jabs that Must be Banned -Pfizer added Tromethamine to it jabs without any clinical trials as a replacement for Phosphate buffer used in it original 4 formulations – READ
December 23, 2022 – Sasha Latypova Substack: Nobody Knows What is in the Vials – Covid-19 injections are dangerous, non-compliant biological materials. Their production must be stopped until a full investigation can be done – “The mRNA shots do not conform to their label specifications” – READ
December 18, 2022 – Jessica Rose Substack: Graphene oxide conjugated to PEG and PEI as a antigen delivery system- This is a thing… and it makes me wonder why they WOULDN’T be using it now – READ
December 18, 2022 – Ana Maria Mihalcea, MD, PhD Substack: Self Assembly Microtechnology Pfizer Vials Research Updates – Ribbons, Microchips, Optical Communications Cables and Correlation to PEG, Graphene, Hydrogel – READ
December 9, 2022 – Zeee Media: Uncensored: Graphene Ribbons Connecting Nanotech Inside Injections – Shimon Yanowitz & Matt Taylor – WATCH
December 8, 2022 – The Highwire Ep 297: BLEEDING TRUTH – includes Dr Ryan Cole & Del Bigtree look under the microscope at various COVID-19 vaccines and their effect on blood – WATCH
Dr Cole explains some “phenomenon” found under the microscope:
December 7, 2022 – Senator Ron Johnson’s roundtable: Dr Renata Moon found intentionally blank package insert in a box of mRNA COVID-19 vaccine product. So informed consent is impossible to be provided by doctors – WATCH, FULL
November 17, 2022 – Vaccine Safety Research Foundation Ep #56: Vile Ingredients – WATCH
November 12, 2022 – Expose News: If we don’t know what’s in Covid vaccines, how can we know what they’re doing? [an excellent overview] – READ
November 12, 2022 – Spartacus Substack: What’s Really in the Shots? – To graphene or not to graphene, that is the question – READ
November 5, 2022 – Expose News: Scientists suspect Covid Vaccines contain Graphene & Nanotech that is damaging the Immune System & causing Cancer – Dr David Nixon, a Brisbane GP put droplets of vaccine and the blood of vaccinated patients under a dark-field microscope. – READ
October 29, 2021 – FDA Press release: DA Authorizes Pfizer-BioNTech COVID-19 Vaccine for Emergency Use in Children 5 through 11 Years of Age – READ, Buffer changed to Tromethamine – READ, CREDIT
September 24, 2022 – NBC News: Less than 4% of eligible people have gotten updated Covid booster shots, one month into the rollout – 7.6 million Americans have received bivalent “booster” – READ, Our World in Data: vaccine uptake – HERE, How bad is my batch – SOURCE
September 22, 2022 – ReAwaken versus The Great Reset tour: Dr. Sheri Tenpenny | What’s In the COVID-19 Vaccines? – WATCH
September 17, 2022 – “COVID-19 Vaccines: What You Should Have Been Told” a presentation by Jonathan Weissman – WATCH, CREDIT, All the Risks – WEBSITE
October 8, 2022 – Ana Maria Mihalecia Substack: The Reason It Is Not Allowed To Analyze C19 vials in the US is BECAUSE IT IS FEDERAL PROPERTY CLASSIFIED AS A WEAPON – Dr Jane Ruby with Sasha Latypova – READ, WATCH
September 6, 2022 – Welcome The Eagle 88: VAERS Bad Batches Hiding In Under-Coded Event Levels – Thousands of myocarditis, cardiac arrests, strokes, embolisms, spontaneous abortions are hiding in the lowest level event category aka “NONE OF ABOVE” – WATCH, DASHBOARD
September 6, 2022 – Epoch Times:: ‘Foreign Metal-Like Objects’ Found in 94 Percent of People Who Took mRNA Vaccines: Italian Doctors: Some ‘appearing as graphene-family super-structures’ – READ, OTHER, Italian Aug22, 2022 – PAPER
September 5, 2022 – World Council for Health: Dr Sabine Stebel from Germany speaks with the World Council For Health – she runs through the German vaccine analysis report which was released July 6, 2022 – (navigate to video date) – @43min WATCH
September 1, 2022 – Steve Kirsh Substack: Documents leaked from the EMA confirms why we aren’t allowed to analyze the vaccine vials – READ, Video from approx March 2021 by Underdog – WATCH, SUBSTACK, Daily Mail – ARTICLE
August 31, 2022 – Stew Peters: Findings in German Study: “Toxic Substances Found in ALL Samples Of C19 Vaccines” – German-Austrian working group of independent scientists, Dr. Sabine Stabel – WATCH, FULL
August 22, 2022 – Epoch Times: Unusual Toxic Components Found in COVID Vaccines, ‘Without Exception’: German Scientists (with images) – READ, [See July 6, 2022 below for preliminary REPORT]
August 19, 2022 – Stew Peters Network | Dr Ruby with Mike Adams: SHOCKING: White Embalmer Clots Are Self Assembling Circuits – WATCH
Mike Adams: These self assembling bio-structures that increase over time, and are harvesting and organising, from the blood, electrically conductive elements such as tin, aluminium and sodium etc. This may be the explanation for “died suddenly” and amputations. They are not “alive”, like prions.
August 12, 2022 – International Journal of Vaccine Theory, Practice, and Research (IJVTPR): Dark -Field Microscopic Analysis on the Blood of 1,006 Symptomatic Persons After Anti-COVID mRNA Injections from Pfizer/BioNtech or Moderna – Giovannini et al – READ, Epoch Times ARTICLE
August 9, 2022 – Ana Maria Mihalcea, MD, PhD Substack: Alarming New Report from Working Group of Vaccine Analysis in Germany and Other Countries -the Vaccines Must Be Stopped Immediately! – READ,
Working Group for COVID Vaccine Analysis – REPORT
August 2, 2022 – Steve Kirsch Substack: Want to know what’s inside the vaccine vials? – One of our colleagues ran a mass spectrometry analysis of 4 vials. – READ
July 26, 2022 – ACTA Scientific Medical Sciences: Scanning and Transmission Electron Microscopy Reveals Graphene Oxide in CoV-19 Vaccines by Robert O’Young – PDF, SOURCE
June 24, 2022 – Orwell City: La Quinta Columna: Analysis of vaccination vial confirms presence of graphene nanoparticles (images shared) – READ, WATCH
July 6, 2022 – The German Working Group for COVID Vaccine Analysis – summary of preliminary findings – wide-ranging report – READ, PDF They call for the vaccination programmes to be discontinued immediately. – SUBSTACK
This report was sent to all members of the Bundestag, then to authorities, media, a total of over 4000 addresses.-REF
“Never in the history of science and medicine has anyone before dared to subject an entire population, an almost entire species, to a medical – not to mention a genetic – experiment.”
Analytical tools reportedly used:
The German group works in close cooperation with several international groups that are carrying out similar investigations and who have obtained results consistent with our own…thus results have been cross-validated.
May 13, 2022 – Dr. Jane Ruby: Pfizer New FOIA Reports From Team Enigma Part 1 with Sasha Latypova – WATCH
May 4, 2022 – KLA TV: Michael Yeadon: Corona vaccines batch scandal – “The Hot Lots” – WATCH, Alarming Data From Canada and Vaccines Batch Scandal – CREDIT
April 18, 2022 – Western Standard Melanie Risdon: Dr. Nagase reviews images from COVID vaccines, shows no ‘elements of life’ – WATCH, READ, ARTICLE, SOURCE
March 21, 2022? – DR. JANE RUBY Welcomes Team ENIGMA [How bad is my batch] who show proof that human safety was never in the plan for Pfizer – WATCH, BACKUP
March 22, 2022 – Dr Sam Bailey: NZ Scientist Examines Pfizer Jab Under The Microscope – There are now 4 teams working on this in New Zealand and Dr Robin Wakeling has agreed to go public with his findings. – WATCH
March 11, 2022 – International Journal of Vaccine Theory, Practice and Research (IJVTPR): Foreign Materials in Blood Samples of Recipients of COVID-19 Vaccines – Young Mi Lee et al – READ, PDF
March 3, 2022 – The Highwire Ep 257: NEW STUDY: MRNA VACCINES MAY ALTER HUMAN DNA – WATCH
March 1, 2022 – Craig Paardekooper | How bad is my batch?: Examines the Repeating 7-Day Cycle of Vaccinations and Deaths – WATCH, READ, TRANSCIPT
February 24, 2022 – Dr. Jane Ruby: Researcher tells Dr. Jane Ruby: FDA, EMA, MHRA approved COVID-19 vaccines without seeing trial data – featuring Team Enigma’s Sasha Latypova – WATCH, READ
February 8, 2022 – Frontiers in Immunology | Hypothesis & Theory: Are There Hidden Genes in DNA/RNA Vaccines? – Beaudoin et al – READ, CREDIT
January 24, 2022 – European Parliament: Time for the truth on the presence of graphene in the COVID-19 vaccines – READ, SOURCE
January 12, 2022 – How Bad is My Batch: Measure of COVID-19 vaccine’s lethality – READ
January 10, 2022 – Stew Peters Show: CDC Whistleblower Drops Nuke: Deadly Bioweapon Lots Targeting Specific Groups – WATCH
January 8, 2022 – Corona Investigative Committee Session 86 with Dr Mike Yeadon talks on vaccine batches and the pharmaceutical manufacturing process – WATCH, BATCH
January 7, 2022 – Stew Peters Show: Evidence: No Vials Are Safe, Full Stops: Terminate Covid-Injection Program Now – WATCH
January 3, 2022 – Stew Peters Show: BREAKING: Deadly Vax Lot Numbers IDENTIFIED, Still in Circulation! – WATCH
December 18, 2021 – The Truth Barrier | Celia Farber: UK Scientist Reveals Bombshell Data Analysis: Tracks Batches Of Pfizer, Moderna and Janssen, Finds “..Some Batches Are 50 Times Worse Than Others” – “How Bad Is My Batch?” Allows People To Input Batch Code – READ
November 11, 2021 – JMBK.News Substack: Tromethamine: Ingredient Added to Pfizer-BioNTech’s Comirnaty for Children Aged 5 – 11 – READ
November 4, 2021 – Frontiers in Cell & Developmental Biology: The Critical Contribution of Pseudouridine to mRNA COVID-19 Vaccines by Morais et al – READ, PDF, CREDIT
November 2, 2021 – La Quinta Columna: FINAL TECHNICAL REPORT ON GRAPHENE DETECTION IN COVID VACCINES where the presence of Graphene Oxide is determined in the samples from Pfzer, Astrazeneca, Moderna and Janssen – by Prof. Dr. Pablo Campra Madrid, Almerial, Spain – REPORT, SOURCE
Graphene Oxide is determined in the samples from:
October 14, 2021 – LifeSite News | Jim Hale : BOMBSHELL: Pfizer whistleblower [Melissa Strickler] says vaccine ‘glows,’ contains toxic luciferase, graphene oxide compounds – READ, WATCH, BACKUP
August 30, 2021 – Orwell City – Graphene oxide and unknown moving elements found in Chiromas flu vaccination vial – READ, WATCH
August 24, 2021 – Orwell City: Electronic component found in AstraZeneca vaccination vial – Graphene oxide isn’t the only nanoelement that goes in the vials. A diode has also been found. – READ, WATCH
August 18, 2021 – Stew Peters | Dr Jane Ruby: VAXXED Patients’ Blood Examined, Horrific Findings Revealed by German Physicians! Dr. Barbel Ghitalla examines blood under the microscope and she also looked at a vial of the Johnson & Johnson jab solution. – WATCH, BACKUP – Also see blood slides in the video.
July 27, 2021 – Orwell City: La Quinta Columna on the Tunable Electrical Conductivity of Graphene – READ
July 25, 2021 – Orwell City: Graphene oxide can be identified through blood tests – READ
July 24, 2021 – Reuters: Fact Check-COVID-19 vaccines do not contain graphene oxide – “Graphene oxide is not used in the manufacture of the Pfizer-BioNTech COVID-19 vaccine,” Pfizer’s Senior Associate of Global Media Relations told Reuters. – READ
July 23, 2021 – Orwell City: Andreas Kalcker’s team confirms evidence of graphene oxide in ‘vaccines’ – TRANSCRIPT, WATCH, Andreas Kalker’s – WEBSITE
“Dr. Kalcker agrees with La Quinta Columna‘s theories and states that all vaccines contain graphene oxide. A nano-material that shouldn’t be in the vials since it generates very serious problems in people’s health due to its ability to interfere with the body’s electromagnetic fields.”
July 22, 2021 – Orwell City: Spectroscopy analysis reveals 99.5% graphene oxide in Moderna vaccination vial – READ, WATCH
“It is not that the whole vial is graphene, but that when the liquid is purified, the signals obtained from this filtrate show that it is 99.5% graphene.”
July 19, 2021 – Orwell City: BREAKING: Graphene Oxide has been found in Vaxigrip Tetra [flu] vaccination vial – READ, WATCH
July 17, 2021 – Orwell City: La Quinta Columna discusses a study on the properties of graphene and their link with EMF – READ, WATCH
This is one of the papers that bring them closer and closer to prove their hypothesis about the real purpose of the elite with mass and forced vaccination: neuromodulation through a material capable of accepting and emitting the frequencies sent by the 5G antennas.
July 14, 2021 – American Media Periscope: Analysis of the Bioweapons with Dr. Lee Merritt – WATCH, Nurses say the COVID-19 vials are not the same, even in the same batch – TIMESTAMP
July 10, 2021 – Orwell City: La Quinta Columna shares UV fluorescence test results that support the claim that the analyzed vaccination vials contain graphene oxide – READ
July 6, 2021 – Tim Truth: New Vax Study With Electron Microscope Shows Particles Similar To Graphene – WATCH
July 5, 2021 – Orwell City: Find out how La Quinta Columna discovered the connection between graphene oxide and electromagnetic fields – TRANSCRIPT, WATCH
Excerpt from the transcript:
“I am referring to the magnetic or pseudo-magnetic phenomenon that people acquire after inoculation. A magnetic phenomenon on the one hand, but also one that turns inoculated people into superconductors and …can be measured with a multimeter …
So from there we started to look for what kind of materials or, better said, nanomaterials can cause those kinds of properties inside the body and we came up with some of the candidates. One of them initially was graphene. Graphene inside the body acquires magnetic properties and is a superconductor.
Without yet having any knowledge of what was inside the vial, we realized that the industry or rather the stock market of the graphene industry had high uptrend peaks just as the COVID-19 vaccination campaign was starting at the beginning of the year, late December [2020] and early January [2021]. But also, quite curious, during the flu vaccination campaign.
…Yes. Graphene can be injected. And, in fact, some scientific papers have already raised the possibility that it could be used as a nanoadjuvant in vaccines. With that hypothesis of suspicion, we did what anyone could have done and what I also recommend that you can do if you have access to a vial.
We had access to a sealed vial from Pfizer…After some time of investigation by Dr. Pablo Campra Madrid, Doctor in Chemical Sciences, Bachelor in Biological Sciences and member of the University of Almeria, we obtained this preliminary report where we are told that there is indeed solid evidence of graphene oxide in the sample and that it is also the main component…”
Ricardo Delgado
[So upon reading this the question comes to mind, were the 2020 COVID-19 diagnosed patients sick as a result of a novel viral infection, or did they become ill following a flu vaccine with possibly graphene oxide, triggered maybe by 5G, or combination of both? – just speculating here as I read this transcript above.]
…we suspect with many credible indications that COVID-19 disease is actually the side effect of the introduction of graphene oxide into the body by different ways. [masks, PCR tests, antigen tests etc!]
...We know that, naturally, graphene oxide is eliminated by the levels of glutathione in the body, and that is why we suspect that they propose a second, third and even fourth dose every so often: so that you have your considerable dose of graphene oxide. In short, we are talking about the simultaneous and gradual mass poisoning of the entire world population.”
When we study glutathione, we realize that it begins to fall from the age of 30 onwards, but above all it falls considerably from the age of 65 onwards…children have high glutathione reserves...glutathione is low in the obese, [and those with low] vitamin D…
…all the elements of…supposed protection…: masks, PCR tests, swabs, antigen tests and vaccine —the wrongly called vaccine— are precisely all those elements that will potentially cause the disease to develop in the future.
And why do I say ‘in the future’? When we studied the electromagnetic phenomenon we realized that graphene oxide has what is called an ‘electronic absorption band‘. The electronic excitation, its magnetic resonance is precisely in the third bandwidth of the 5G technology, the one that is being tendered right now and that, remember, has been with us throughout the pandemic.
We observed that the higher the flu vaccination, the higher the mortality of COVID-19, and logically we saw a relationship. The other relationship was with electromagnetic fields….
READ THE TRANSCRIPT!
June 30, 2021: Orwell City: Official interim report of Pfizer’s vaccination vial analysis explained by Dr. José Luis Sevillano and Ricardo Delgado of La Quinta Columna – READ, WATCH
May 29, 2021 – BluetoothGate: My mother has Bluetooth connectivity – WATCH, READ
May 17, 2021 – FDA attempts to stop OTC sales of N-acetyle cysteine, an adjunctive treatment for Covid-19 [This is the precursor for glutathione that degrades graphene oxide!] – READ & READ
May 16, 2021 – ZDnet: Services Australia rebuilds immunisation register with IBM ahead of COVID-19 vaccination rollout – (batch number recording) – READ
March 23, 2021 – TGA: Melbourne-manufactured AstraZeneca vaccine is now available for Australians – CSL-Seqirus – ARCHIVE,
March 23, 2021 – MagnetGate: Claudia Pacheco, a Chilean teacher reported her case of 2 mobile phones sticking to her arm at her Sinovac COVID-19 vaccine injection site. – WATCH, READ, MORE
March 10, 2021 – BMJ Investigation: The EMA covid-19 data leak, and what it tells us about mRNA instability – by Serena Tinari – READ, PDF, Steve Kirsh Substack – CREDIT, Dr Rose Substack – READ
February 19, 2021 – European Medicine Agency | Committee for Medicinal Products for Human Use (CHMP): EMA/707383/2020 – Assessment report for Pfizer’s Comirnaty – PDF, CREDIT
Contains information on what was known about Comirnaty’s Lipid nanoparticles – ALC-0315 and ALC-0159 are functional lipids and DSPC and cholesterol are structural lipids. ALC-0315 and ALC-0159, are classified as novel excipients. Because DSPC is used in “Onpattro” [see 2018 below] it is “justified” as not being novel
The lipid nanopartice lipids can be purchased from cayman chemicals such as “LNP-102” – PDF
November 23, 2020 – RETROSPECT Leaked documents: EMA knew about the quality control issues with severely compromised mRNA integrity (ranging from 78% to 55%)….and more – READ
November 6, 2020 – Vaxxter: Chilling Ingredient Used in the COVID-19 Vaccine – blue blood from horseshoe crabs used to test vaccines are free of bacteria – READ, NY Times – READ, WEF – READ
December 4, 2019 – Nature Nanotechnology: The Onpattro story and the clinical translation of nanomedicines containing nucleic acid-based drugs – Akinc et al – READ Ontattro is a (small interfering) siRNA-based drug – WIKI
June 25, 2019 – American Chemicals Society: Carriers Break Barriers in Drug Delivery: Endocytosis and Endosomal Escape of Gene Delivery Vectors – Degors et al – READ
August 10, 2018 – Science News: The first gene-silencing drug wins FDA approval- Using RNA interference, patisiran prevents symptoms by blocking DNA instructions – READ, WSJ: A New kind of drug – READ, (see Dec 4, 2019 above), NEJM (Phase 3 clinical trial with 225 patients) – READ
The post What is in the COVID-19 Vaccines? first appeared on Totality of Evidence.
]]>